The double nickase Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated protein 9 (CRISPR/Cas9) plasmids designed by Santa Cruz Biotechnology were used to knock out ERBB2 in cells. ERBB2 double nickase plasmid (NIC-ERBB2) and the control double nickase plasmid (NIC-Con) were transfected into SKBR3 cells using Lipofectamine 2000. Then, stable cell lines were developed with puromycin selection followed by single colony pickup. ERBB2 knockout was verified by Western blotting and its effect on autophagy was confirmed by comparison experiments with ERBB2 siRNA knockdown. The pair of cell lines (NIC-Con cell line and NIC-ERBB2 cell line) developed from the same parental SKBR3 cell line was developed and maintained parallelly so that the results generated from these two cell lines can be comparable.
Crispr cas9
Manufactured by Santa Cruz Biotechnology
Sourced in United States, Germany
CRISPR/Cas9 is a gene editing tool that uses a guide RNA and the Cas9 enzyme to target and modify specific DNA sequences. It enables the precise and efficient manipulation of genetic material.
Automatically generated - may contain errors
Lab products found in correlation
D luciferin, by GoldBio (3 mentions)
Infinite m1000 pro, by Tecan (3 mentions)
Escherichia coli o26 b6, by Merck Group (2 mentions)
Camptothecin, by Merck Group (1 mentions)
Anti mre11, by Cell Signaling Technology (1 mentions)
Mirin, by Merck Group (1 mentions)
5 ethynyl 2 deoxyuridine (edu), by Merck Group (1 mentions)
Alexaflour 546, by Jackson ImmunoResearch (1 mentions)
Lipofectamine 2000 3000, by Thermo Fisher Scientific (1 mentions)
Anti fade gold, by Thermo Fisher Scientific (1 mentions)
Sch900776, by Selleck Chemicals (1 mentions)
Alexa flour 488, by Jackson ImmunoResearch (1 mentions)
β actin, by Merck Group (1 mentions)
Puromycin, by Thermo Fisher Scientific (1 mentions)
Transit x2 transfection reagent, by Mirus Bio (1 mentions)
Puromycin, by Merck Group (1 mentions)
Escherichia coli 026 b6, by Merck Group (1 mentions)
12 protocols using crispr cas9
1
CRISPR/Cas9-Mediated ERBB2 Knockout
2
Immunofluorescence Analysis of DNA Damage Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies against TOP1, IκBα, phospho‐ATM, γH2AX, DNA. FLAG, β‐actin, Anti‐IKKγ/NEMO TDP1 (#SAB1411073), and H2AX were purchased from Sigma (St. Louis, MO). Antibodies against RPA2 and phospho‐RPA2 were from Bethyl Laboratories (Montgomery, TX). Antibodies against p65, WRN (#SC5629), ATM (#SC23921), CHK1 (#SC8404), Lamin B (#SC6216), and CRISPR‐Cas9 double nickase plasmid (control and WRN) were from Santa Cruz biotechnology (Santa Cruz, CA). Anti‐phospho‐345‐CHK1 was from Epitomics (Cambridge, UK). Anti‐BrdU (#347580), anti‐PAR from BD Biosciences (San Jose, CA). Anti MRE11 (#4847) from Cell Signaling Technology (Massachusetts, USA). AlexaFlour‐546 and AlexaFlour‐488 tagged secondary antibodies from Jackson ImmunoResearch, (PA, USA). Lipofectamine 2000/3000, Alexa Flour‐488/555/595 (#A21123/#A31570), prolong anti‐fade Gold was obtained from (Life Technologies, Carlsbad, CA). SCH900776 (CHK1 inhibitor) was purchased from Selleckchem (Houston, USA). Talazoparib (BMN673; PARP inhibitor) was procured from ApexBio, USA. All other reagents like Ro106‐9920, mirin (MRE11 inhibitor), camptothecin, EdU, etc., were obtained from Sigma Chemicals (St. Louis, MO), unless mentioned in the respective places.
3
CRISPR-mediated p53 and Nek2 knockout
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human p53-specific siRNA was purchased from Santa Cruz Biotech. CRISPR/Cas9 was used to delete p53 or Nek2 from cultured mouse cell lines by transfecting cells with p53 or Nek2 double nickase plasmid (Santa Cruz Biotech), using TransIT-X2® Transfection Reagent (Mirusbio) according to manufacturer’s recommendations. Selection of transfected cells was done by adding puromycin (6 μg/ml) (Fisher) to culture media 2 days post transfection. Selected cells were maintained in media with puromycin (6 μg/ml) throughout.
4
HPIP Knockout in Chondrocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HPIP knockout (KO) chondrocytes were generated by CRISPR/Cas9 (Santa Cruz Biotechnology, Inc.). The CRISPR/Cas9 KO Plasmid (sc-412788) and the control CRISPR/Cas9 Plasmid (sc-418922) infection for HPIP were performed according to the manufacturer’s instructions. Briefly, the Plasmid DNA solution was added directly to the dilute UltraCruz® Transfection Reagent (sc-395739) using a pipette, and incubated for 30 min at room temperature. Then the chondrocytes were incubated for 24–72 h under conditions normally used to culture the cells. The KO efficiency of HPIP in chondrocytes was then confirmed by western blotting.
5
CRISPR-Cas9 Targeting PLAUR Exon 3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmids (sc-400666-NIC) for CRISPR/Cas9, targeting PLAUR exon 3, were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and transfected according to the manufacturer’s instructions. sgRNA were, however, subjected to off-target sites analysis throughout the Cas-OFF Finder software (http://www.rgenome.net/cas-offinder/ ). No off-target sites in the loci of the most likely off-target activity of the CRISPR/Cas9 system targeted by the chosen sgRNAs could be detected as shown in Table 1 . Cells were then sorted for the Green Fluorescent Protein (GFP) marker and selected with 1 µg/mL puromycin for 2–3 weeks (Sigma-Aldrich, Saint Louis, MO, USA), which is singularly characterized using Western Blotting, qPCR and PCR on the full-length mRNA. For the uPAR rescue expression experiment, cells were stably transfected using an Okayama-Berg vector containing uPAR cDNA, and they were selected with G418 as resistance marker (0.5 mg/mL) as previously reported [23 (link)].
6
Cytotoxicity Assay with Engineered Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
2 × 105 target cells (HMEC-1, bEnd.3, HeLa, and 8505c) stably transduced to express GFP and firefly luciferase were co-cultured with either non-transduced or transduced T cells at varying effector to target ratios (E:T). The number of effector T cells was the total number of T cells without accounting for the difference in the level of transduction. In certain conditions, the ICAM-1 gene was disrupted in 8505 C cells using CRISPR/Cas9 (Santa Cruz, #sc-400098; denoted as 8505 C/-ICAM-1) or alternatively, 8505 C cells were exposed to 1 μg/ml lipopolysaccharide (LPS; Escherichia coli O26:B6, Sigma) for 12 h to induce overexpression of ICAM-1 (denoted as 8505 C/LPS). Co-cultures were carried out in T cell culture medium containing 150 µg/ml D-Luciferin (Gold Biotechnology) and no cytokine supplementation. Luminescence was measured using a plate reader (TECAN infinite M1000 PRO) with readings in each E:T condition normalized to the non-transduced T cell:target co-culture controls.
7
Generation of Knockout Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The HEK293A YAP knockout cell line (generated by CRISPR-Cas9) was a gift of Dr. Junjie Chen. For the generation of SKP2 and OTUD1 knockout cell lines, CRISPR-Cas9 constructs from Santa Cruz Biotechnology (SKP2: sc-400534; OTUD1: sc-405431) were used. HEK293A cells were transfected with the gRNA expression vector containing GFP, sorted by GFP and seeded in 96-well plates for single colony isolation. The isolated clones were subjected to sequencing and western blot analysis.
8
Knockout of Cdc50a and Atp11a in C2C12 Myoblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse C2C12 myoblasts (ATCC CRL-1772 ; Blau et al., 1985 (link)) and rat L6 myoblasts (ATCC CRL-1458 ; Yaffe, 1968 (link)) were maintained in uncoated standard tissue culture plastic flasks in a humidified incubator at 5% CO2 and 37°C in GM. At 70% confluency, cells were trypsinized (0.125% trypsin, 0.02% EDTA in HBSS) and split at a 1:3 ratio. Myotube formation was induced by replacing GM with DM. DM was changed every day. To knockout the Cdc50a or Atp11a genes, C2C12 cells were transfected with a combination (1:1) of CRISPR-Cas9 and homology-directed repair (HDR) reporter vectors (Santa Cruz Biotechnology, Heidelberg, Germany) and selected with puromycin (1 μg ml−1). Biallelic integration of the HDR cassette to genomic loci was confirmed by PCR using the primers listed in Table S2 .
9
ICAM-1 modulation of CAR T-cell cytotoxicity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 4
2×105 target cells (HMEC-1, bEnd.3, HeLa, and 8505c) stably transduced to express GFP and firefly luciferase were co-cultured with either non-transduced or I domain CAR T cells at varying effector to target ratios (E:T). In certain conditions, the ICAM-1 gene was disrupted in 8505C cells using CRISPR/Cas9 (Santa Cruz, # sc-400098; denoted as 8505C/-ICAM-1) or, alternatively, 8505C cells were exposed to 1 μg/ml lipopolysaccharide (LPS; Escherichia coli 026:B6, Sigma) for 12 h to induce overexpression of ICAM-1 (denoted as 8505C/LPS). Co-cultures were carried out in T cell culture medium containing 150 μg/ml D-Luciferin (Gold Biotechnology) and no cytokine supplementation. Luminescence was measured using a plate reader (TECAN infinite M1000 PRO) with readings in each E:T condition normalized to the non-transduced T cell:target co-culture controls.
10
Generating Pin1 Knockout in DU145 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To achieve Pin1 gene knockout in DU145 cells, both the Pin1 Crispr/Casp plasmid and the Pin1 HFD plasmid were transfected into DU145 cells. After two days, cells were exposed to 5 μg/ml puromycin for selection. The cells were then seeded into a 96-well plate for limiting dilution analysis. Pin1 knockout was confirmed by immunoblotting. We used pre-designed Crispr/Cas9 (sc-400485) purchased from Santa Cruz. This commercial Crispr/Cas9 contains three different gRNA pools and the sequences are as follows: AAGCGCATGAGCCGCAGCTC: GATGAGCGGGCCCGTGTTCA: AAGACGCCTCGTTTGCGCTG.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!