Total RNA of the colon tissue was isolated using Trizol regent (Tiangen Biotech, Beijing, China). cDNA was prepared using EasyScript Plus cDNA synthesis kit (ABM, Richmond, BC, Canada) following the manufacturer’s instructions. Synthesized cDNA was used as a template and quantified using a Techne Quantica real-time PCR detection system (Techne, Stone, Staffordshire, UK). The thermal cycling condition and reaction system for qRT-PCR analysis were based on a previous report [27 (link)]. Primer sequences for the target genes were: forward, 5′-CATCTTCTCAAAATTCGAGTGACAA-3′; reverse, 5′-TGGGAGTAGACAAGGTACAACCC-3′ for the TNF-α gene; forward, 5′- AACGATGATGCACTTGCAGA -3′; reverse, 5′- GAGCATTGGAAATTGGGGTA -3′ for the IL-6 gene; forward, 5′-AATCTCGCAGCAGCACATCAACA-3′; reverse, 5′- GTTGTTCATCTCGGAGCCTGTAGTG for the IL-1β gene; forward, 5′-TGGCAAAGTGGAGATTGTTGC-3′; reverse, 5′-AAGATGGTGATGGGCTTCCCG-3′ for the GADPH gene. The house-keeping gene GADPH was used as a reference.
Trizol regent
Manufactured by Tiangen Biotech
Sourced in China
Trizol reagent is a mono-phasic solution of phenol and guanidine isothiocyanate. It is used for the isolation of total RNA from various biological samples, including cells, tissues, and microorganisms.
Automatically generated - may contain errors
Lab products found in correlation
Dnase 1, by Tiangen Biotech (2 mentions)
Easyscript plus cdna synthesis kit, by Applied Biological Materials (1 mentions)
Mulv reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Reverse transcription kit, by Promega (1 mentions)
Cfx96 touch, by Bio-Rad (1 mentions)
Tb green premix ex taq reagent, by Takara Bio (1 mentions)
Cfx96, by Bio-Rad (1 mentions)
Reverse transcription kit, by Tiangen Biotech (1 mentions)
Nanodrop one, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix kit, by Toyobo (1 mentions)
Superscript reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
8 protocols using trizol regent
1
Quantitative Analysis of Inflammatory Cytokines
2
Liver RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from liver samples with Trizol regent (Tiangen), followed by purification and was reverse transcribed with MuLV reverse transcriptase (Thermo, Lithuania) and oligo-dT primers. The forward and reverse primer sequences for selected genes were designed with Primer 3 online software and are listed in Table 1 . Gene expression was then determined using 2×SYBR green PCR master mix (Biomiga). The relative differences in expression between groups were calculated using the ΔΔCt method.
3
Transcriptional Profiling of Stem Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted with Trizol regent (Tiangen, China) and reverse-transcribed to cDNA using the Reverse Transcription Kit (Promega, China). Then, qRT-PCR was conducted on CFX96 Touch (Bio-Rad, Hercules, CA, United States) system with thermocycling conditions followed as 95°C for 3 min, 40 cycles for 95°C for 12 s and 62°C for 40 s. The relative expression of CD4, RUNX2, OMD, COL9A3, and JUN was calculated with 2−ΔΔCT method and GAPDH as a housekeeping gene. The primer sequences of these genes are listed in Supplementary Table S1 .
4
RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from samples of jejunum, ileum, and colon with TRIzol regent (Tiangen Biotech, Beijing) and then treated with DNase I (Tiangen Biotech, Beijing) according to the manufacturer's instructions. Subsequently, we tested the integrity, purity, and concentration of RNA. Fastking cDNA first-strand synthesis Kit, Super real premix plus, 2 × Taq PCR mastermix, and 5 × RNA loading buffer were purchased from Beijing Tiangen Biochemical Technology Co., Ltd. The PCR reaction process was as follows: 95°C for 2 min, followed by amplification in 40 cycles of 95°C for 5 s, 15 s at 60°C, and 20 s at 72°C, and then 65°C and 95°C for 5 s, using the C1000 TouchTM Thermal Cycler Real-Time System (Bio-Rad). Referring to the data of the National Center for Biotechnology Information (NCBI) database, fluorescent quantitative-specific primers were designed by primer 5.0 software. All primers are synthesized by Thermo Fisher Technology Co., Ltd. and are presented in Table 2 . GAPDH was used as an internal control to normalize the expression of target gene transcripts.
5
Quantifying mRNA Expression in Mouse Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA in small intestine and liver tissues was extracted by applying TRIzol regent (Tiangen Biotech Co., Ltd., Beijing, China). EasyScript Plus cDNA synthesis kit (Takara Bio, Shiga, Japan) was used to synthesize cDNA according to the manufacturer’s protocol. qRT-PCR assay was carried out in a reaction system of 25 µl by applying TB Green Premix Ex Taq reagent (Takara Bio, Shiga, Japan) with the fluorescent PCR instrument (CFX96; Bio-Rad Laboratories Inc., Hercules, CA, USA). The amplification reaction was undertaken as follows: at 95 °C for half a minute, followed by 40 cycles at 95 °C for 5 s and at 60 °C for half a minute. Besides, β-actin, as a house-keeping gene, was used as a reference. Relative gene expression levels were determined using the 2 method. The primer sequences for the target genes are listed in Table S2.
6
Mycosubtilin Transcriptomic Analysis in Arabidopsis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Arabidopsis Col-0 seedlings grown on MS medium for 10 days were planted in six-well plates containing 50 μg/mL mycosubtilin, and those planted in plates with dd H2O served as controls. The whole plant samples were collected at 12 h after treatment and sent to Shanghai Meiji Biologicals (http://www.majorbio.com/ , accessed on 31 July 2020), China, for transcriptome sequencing. Three biological replicates were performed per sample.
Arabidopsis Col-0 seedlings were treated with 50 μg/mL mycosubtilin for 12 h. Total RNA was extracted from each group of samples by TRIzol regent (Tiangen, Beijing, China), and the nucleic acid concentration was measured using an ultra-micro spectrophotometer (Thermo Fisher™ NanoDrop One, Waltham, MA, USA). The RNA was reverse transcribed into cDNA using a reverse transcription kit (Tiangen, Beijing, China ), The qRT-PCR reaction was performed on the Real-Time PCR instrument (ABI StepOne™, FosterCity, CA; USA). Data were standardized using AtActin and three replicates were made. Specific primers were designed according to the gene sequence, and primer sequences are shown inTable S4 .
Arabidopsis Col-0 seedlings were treated with 50 μg/mL mycosubtilin for 12 h. Total RNA was extracted from each group of samples by TRIzol regent (Tiangen, Beijing, China), and the nucleic acid concentration was measured using an ultra-micro spectrophotometer (Thermo Fisher™ NanoDrop One, Waltham, MA, USA). The RNA was reverse transcribed into cDNA using a reverse transcription kit (Tiangen, Beijing, China ), The qRT-PCR reaction was performed on the Real-Time PCR instrument (ABI StepOne™, FosterCity, CA; USA). Data were standardized using AtActin and three replicates were made. Specific primers were designed according to the gene sequence, and primer sequences are shown in
7
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction of total RNA from transiently transfected cells was performed using Trizol Regent (Tiangen, Beijing, China). Subsequently, cDNA synthesis was carried out using a Superscript Reverse Transcriptase kit (Thermo, USA), following the directions provided by the manufacture. The information on primer sequences can be found in Supplementary Table S1. The SYBR Green PCR Master Mix Kit (TOYOBO) was utilized for the PCR amplification procedure. The expression data were computed utilizing the 2−△△Ct approach and normalized by employing GAPDH as an internal reference to regulate the relative expression levels.
8
Immunohistochemical and RT-PCR Analysis of Intestinal Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The abundance of SIgA was assessed for para n embedded slides after the sections were dewaxed.
Endogen biotin and non-speci c signals were blocked with appropriated reagents. Antigen retrieval was carried out in a microwave oven (two cycles for 5 min each at 780 W, in citrate buffer, pH 6.0, twice washed in PBS for 5 min each). Then, the treated slides were overnight incubated with primary antibodies at -4℃ in a humidi ed chamber, washed in PBS, and visualized by biotinylated secondary antibodies followed by stained by DAB kit for 2 min, washed in distilled water. Finally, counterstained with Hematoxylin, dehydrated, transparentized and sealed. At least 10 elds of view from each sample were analyzed with the image analysis software for each protein of interest.
Zo-1, Claudin-1, Occludin, SGLT1 and GLUT2 level assay Total RNA was isolated from samples of jejunum, ileum and colon with TRIZOL regent (Tiangen Biotech, Beijing) and then treated with DNase I (Tiangen Biotech, Beijing) according to the manufacturer's instructions. Primers used in this study are presented in Table 2. GAPDH was used as an internal control to normalize expression of target gene transcripts. Real-time PCR was performed as previous studies described (Yin et al., 2015) .
Endogen biotin and non-speci c signals were blocked with appropriated reagents. Antigen retrieval was carried out in a microwave oven (two cycles for 5 min each at 780 W, in citrate buffer, pH 6.0, twice washed in PBS for 5 min each). Then, the treated slides were overnight incubated with primary antibodies at -4℃ in a humidi ed chamber, washed in PBS, and visualized by biotinylated secondary antibodies followed by stained by DAB kit for 2 min, washed in distilled water. Finally, counterstained with Hematoxylin, dehydrated, transparentized and sealed. At least 10 elds of view from each sample were analyzed with the image analysis software for each protein of interest.
Zo-1, Claudin-1, Occludin, SGLT1 and GLUT2 level assay Total RNA was isolated from samples of jejunum, ileum and colon with TRIZOL regent (Tiangen Biotech, Beijing) and then treated with DNase I (Tiangen Biotech, Beijing) according to the manufacturer's instructions. Primers used in this study are presented in Table 2. GAPDH was used as an internal control to normalize expression of target gene transcripts. Real-time PCR was performed as previous studies described (Yin et al., 2015) .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!