To develop NILs, RILs maintaining heterozygosity at the CESA4 locus in the F6 generation were identified (Loudet et al., 2002 (link)). One plant per RIL carrying a heterozygous CESA4 locus was identified via genotyping and selfed to obtain the F7 seeds. Within the F7 plants, pairs of lines were identified that were either homozygous for the CESA4Bay and CESA4Sha alleles to generate the NILs used in this study. The nearly isogenic lines analyzed in this study were developed from RIL93 and RIL350 segregating for the CESA4 region. Individual HIF plants were genotyped for the Bay-0 or Sha CESA4 allele by PCR of a 543 bp of CESA4 promoter with primers described in Supplementary Table 2 . PCR products were subjected to restriction enzyme digestion with BsrDI (New England BioLabs, Ipswich, MA, United States) at 65°C for 2 h. The Sha allele incudes a BsrDI cut site (CGTTAC| NN) resulting in 401 and 142 bp fragments. The 543 bp Bay-0 allele contains no BrsDI restriction sites and remains undigested. Transcript abundance of CESA4 in the near isogenic lines (NILs) was quantified in 5 cm stems. Stem tissue was frozen in liquid nitrogen and pulverized with metal beads in a Retsch (Haan, Germany) Mixer Mill MM400. RNA extraction and cDNA synthesis was conducted as described above. Primers for CESA4 real-time PCR are described in Supplementary Table 2 .
Bsrdi
Manufactured by New England Biolabs
Sourced in United States
BsrDI is a Type II restriction enzyme that recognizes and cleaves the DNA sequence 5'-GCAATG-3'. It is commonly used in molecular biology applications such as DNA cloning, fragment analysis, and site-directed mutagenesis.
Automatically generated - may contain errors
Lab products found in correlation
Ampure bead, by Beckman Coulter (1 mentions)
Nb bsrdi, by New England Biolabs (1 mentions)
Antarctic phosphatase, by New England Biolabs (1 mentions)
Genomic dna purification kit, by Qiagen (1 mentions)
Bspqi, by New England Biolabs (1 mentions)
Phosphocreatine disodium, by Merck Group (1 mentions)
Creatine phosphokinase, by Merck Group (1 mentions)
8 protocols using bsrdi
1
Generating Near-Isogenic Lines for CESA4 Genetics
2
GLOE-Seq Library Preparation from Yeast Genomic DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purified genomic DNA from yeast strain W303 was treated with 1 U/μg DNA of the relevant restriction or nicking enzymes, BsrDI, Nb.BsrDI or NotI (New England Biolabs) for 90 min at 65°C (BsrDI and Nb.BsrDI) or 37°C (NotI), dephosphorylated with 2 U/μg Antarctic Phosphatase (New England Biolabs) for 30 min at 37°C and purified using AMPure beads (Beckman Coulter). The purified DNA was quantified (Qubit, Life Technologies), and 2.5 μg were used for GLOE-Seq library preparation (steps 29-50) and sequencing. Raw GLOE-Seq data from these experiments were processed with GLOE-Pipe in the indirect mode for downstream analysis, but visualized in the direct mode (Figure 1 B). Significant peaks were assigned by comparing the BED file for each strand to an undigested sample, when possible, using MACS2 callpeak (Zhang et al., 2008 (link)) (version 2.1.1; parameters: --extsize 1, --nomodel, --shift 0, --keep-dup). Custom code based on ChIPseeker package (Yu et al., 2015 (link)) (version 1.14.1) was used to check the overlap between the detected and expected breaks.
3
Genotyping of GAS5 lncRNA Polymorphisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We extracted gDNA from the peripheral blood lymphocytes using a genomic DNA purification kit (Qiagen, Guangzhou, China). Two functional polymorphisms of GAS5 lncRNA were selected based on previous reports.29 (link),35 (link) Polymerase chain reaction (PCR) was used for the genotyping of rs145204276 and rs55829688 as described previously.36 (link) The primers for the amplification of rs145204276 were (F: 5’- TCCCGACTGAGGAGGAAGAGCA-3’; R: 5’-AACACCGTCCCGGAAGTGAAA-3’). The PCR products were separated using 7% native polyacrylamide gel electrophoresis and were visualized by silver staining. The genotypes were designated as ins/ins (II), del/ins (ID), or del/del (DD) for each individual. Primers used for the amplification of rs55829688 were: (F: 5’-TGGCTTAGAAGTCCCAGTCA-3’; R: 5’-CGTCCCGGAAGTGAAATCC-3’). Next, the restriction fragment length polymorphism (RFLP) analysis was performed on the amplified PCR products using restriction enzyme BsrDI (NEB, Beijing, China). For quality control, duplicate sequencing of 10% of samples was performed, with a 100% concordance rate.
4
Genotyping Assay for 19007C>T SNP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nested PCR products containing the 19007C>T SNP were digested overnight using BsrDI (New England Biolabs, Ipswich, MA, USA) as per the manufacturer’s instructions, leading to C/C (333 bp), C/T (333 bp, 242 p and 91 bp), and T/T (242 bp, 91 bp).
5
Plasmid DNA Digestion and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid DNA templates were digested
with BspQI and BsrDI from New England Biolabs (Ipswich, MA) to yield
three DNA fragments: two high-molecular-weight fragments and one lower-molecular-weight
fragment containing the poly(A) sequence. These sizes of the poly(A)
containing fragments were determined by capillary electrophoresis
using Agilent’s D1000 TapeStation kit and the standard ladder
as described by the vendor’s protocol (CA).
with BspQI and BsrDI from New England Biolabs (Ipswich, MA) to yield
three DNA fragments: two high-molecular-weight fragments and one lower-molecular-weight
fragment containing the poly(A) sequence. These sizes of the poly(A)
containing fragments were determined by capillary electrophoresis
using Agilent’s D1000 TapeStation kit and the standard ladder
as described by the vendor’s protocol (CA).
6
PCR Sample Restriction Digest
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ten micrograms of purified PCR sample was digested at 65℃ for 16 hours with 10 U of restriction endonuclease BsrDI (New England Biolabs, Ipswich, MA, USA). Digested fragments were separated by electrophoresis on a 3% agarose gel.
7
Rapid Diagnostic Assay for Coastal and Interior Western Scrub-Jays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Phylogenies based on mtDNA have been characterized in previous studies of Western Scrub-Jays using a limited numbers of individuals [23 (link),24 (link)]. Our goal was to conduct deep mtDNA sampling across the range of the species and assign coastal and interior types to determine the extent of mixing within populations, and to determine whether rare long-distance dispersal events have occurred.
Instead of direct sequencing, we screened individuals for coastal versus interior mtDNA type with a rapid, diagnostic assay. We used previously sequenced individuals [24 (link)] to identify a rare-cutting restriction enzyme that differed between coastal individuals, which had the cut site, and interior individuals, which did not. Then, for new samples of unknown haplotype, we amplified the cyt b gene using previously published primers and PCR conditions [24 (link)]. Once completed, we added 0.5 μL of BSR-DI (2000 U/mL, New England Biolabs, Ipswitch, MA) to each reaction and incubated for one hour at 65°C, followed by visualization on an agarose gel. We scored individuals having two bands as coastal and individuals having one band as interior, employing both positive and negative controls. We ran samples where mtDNA type conflicted with geographic (sampling) location a second time to confirm the result.
Instead of direct sequencing, we screened individuals for coastal versus interior mtDNA type with a rapid, diagnostic assay. We used previously sequenced individuals [24 (link)] to identify a rare-cutting restriction enzyme that differed between coastal individuals, which had the cut site, and interior individuals, which did not. Then, for new samples of unknown haplotype, we amplified the cyt b gene using previously published primers and PCR conditions [24 (link)]. Once completed, we added 0.5 μL of BSR-DI (2000 U/mL, New England Biolabs, Ipswitch, MA) to each reaction and incubated for one hour at 65°C, followed by visualization on an agarose gel. We scored individuals having two bands as coastal and individuals having one band as interior, employing both positive and negative controls. We ran samples where mtDNA type conflicted with geographic (sampling) location a second time to confirm the result.
8
FEN-1 Mediated DNA/RNA Flap Removal
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To examine of the removal of DNA and RNA flaps by FEN-1 in Supplementary Fig. 4, RrcDNA (60 ng) or NA-RrcDNA (60 ng) was incubated with 20 nM FEN-1 in reaction buffer modified from a previous study43 (link) consisting of 20 mM Tris-HCl (pH 7.6), 50 mM KCl, 0.1 mM dNTP, 5 mM MgCl2, 1 mM reduced glutathione, 2.6 mM ATP, 26 mM phosphocreatine disodium (Sigma Aldrich), and 6 μg ml−1 creatine phosphokinase (Sigma Aldrich). The reaction was terminated at indicated time point and the repair products purified as described in the cccDNA formation assay. The purified repair products were digested with BsrDI (NEB) and subsequently resolved on a denaturing 8% (w/vol) urea-PAGE gel. The removal of RNA flap from the plus-strand was detected by Southern blot as described above using alkaline-labile DIG-labeled HBV probe specific for Pd fragment (Supplementary Fig. 4b , GACATTGCAGAGAGTCCAAGAGTCCTCTTATGTAAGACCTTGGGCAACATTCGGTGGGCGTTCACGGTGGTCTCCATGCGACGTGCAGAG). The membrane was subsequently stripped by 0.4 M NaOH and the removal of DNA flap from the minus-strand was detected by alkaline-labile DIG-labeled HBV probe specific for Md fragment (Supplementary Fig. 4b , AACGACCGACCTTGAGGCATACTTCAAAGACTGTTTGTTTAAAGACTGGGAGGAGTTGGGGGAGGAGATTAGATTAAAGGTCTTTGTACT).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!