Anti calreticulin

Manufactured by Abcam

Sourced in United Kingdom, United States

Anti-Calreticulin is a lab equipment product that can be used to detect and quantify the presence of calreticulin, a calcium-binding protein found in the lumen of the endoplasmic reticulum. This product is suitable for a variety of research applications that require the identification and measurement of calreticulin levels.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Rabbit anti-calreticulin Rabbit anti-calreticulin antibody Anti-calreticulin primary antibody Alexa Fluor® 647-conjugated anti-calreticulin antibody Mouse anti human Calreticulin Fluorophore-conjugated anti-calreticulin antibody Anti-calreticulin (CRT) Recombinant PE anti-calreticulin antibody Anti-calreticulin antibody Alexa Fluor® 488 anti-calreticulin antibody

24 protocols using anti calreticulin

Isolation and Characterization of Exosomes

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

We isolated the serum exosomes as previously described (Lv et al., 2017 (link)). We first performed differential centrifugation (1000 g for 10 min at 4°C, and 16,500 g for 30 min at 4°C) to remove the cell debris, followed by ultrafiltration using 0.22 μm filters. We then performed ultracentrifugation (120,000 g for 2 h) to obtain exosome pellets.
Transmission electron microscopy (TEM) combined with immunogold labeling was employed to visualize exosomes (Melo et al., 2015 (link)). The exosome pellets were first suspended and dropped onto 200 mesh formvar carbon-coated nickel grids, followed by incubation with 50 mM glycine. After being blocked with 5% bovine serum albumin (BSA), the samples were incubated with rabbit anti-human antibodies (anti-CD9 (SBI, United States), anti-CD63 (SBI, United States), anti-Hsp70 (SBI, United States) and anti-Calreticulin (Abcam, United States)). The samples were then incubated with the goat anti-rabbit secondary antibody conjugated with protein A-gold particles (10 nm) (Bioss, China), followed by negatively stained with 3% phosphotungstic acid for 10 min. The exosome-containing grids were air-dried and observed using a JEM-1400 TEM (JEOL, Japan). In addition, we analyzed the exosome size distribution using nanoparticle tracking analysis (NTA, Malvern, United Kingdom) according to the manufacturer’s instructions.

Lyu L., Zhang X., Li C., Yang T., Wang J., Pan L., Jia H., Li Z., Sun Q., Yue L., Chen F, & Zhang Z. (2019). Small RNA Profiles of Serum Exosomes Derived From Individuals With Latent and Active Tuberculosis. Frontiers in Microbiology, 10, 1174.

+ Open protocol

+ Expand

Immunohistochemical Analysis of Excised Tumors

Check if the same lab product or an alternative is used in the 5 most similar protocols

Excised tumors fixed in 10% neutral buffered formalin (Azer Scientific, Morgantown PA, USA) were paraffin embedded, sectioned into 5- micron slices, and stained with anti-cleaved caspase 3 (Cell Signaling, Danvers MA, USA), anti-High Mobility Group Box I (HMGB1; Abcam, Cambridge UK), or anti-Calreticulin (Abcam), followed by secondary antibody (Vector Laboratories, Newark CA, USA) and counter stained with hematoxylin. Marker expression was determined by Aperio Image Scope algorithm.

Uccello T.P., Lesch M.L., Kintzel S.A., Gradzewicz L.B., Lamrous L., Murphy S.P., Fleming F.J., Mills B.N., Murphy J.D., Hughson A., Hannon G., Garrett-Larsen J., Qiu H., Drage M.G., Ye J., Gavras N.W., Keeley D.C., Love T.M., Repasky E.A., Lord E.M., Linehan D.C, & Gerber S.A. (2023). New insights into the responder/nonresponder divide in rectal cancer: Damage-induced Type I IFNs dictate treatment efficacy and can be targeted to enhance radiotherapy. Cell Death & Disease, 14(7), 470.

+ Open protocol

+ Expand

Immunogenic Cell Death Markers in Reovirus-Treated Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

FACS analysis was used to determine expression of ICD determinants on the surfaces of reovirus-treated cells. Cell lines untreated, treated with reovirus (MOIs at IC₅₀, 3 for PC3, 40 for DU145, and 0.06 for TRAMP-C2), or exposed to heat-inactivated reovirus for 24, 48, and 72 h were incubated with anti-HSP70 (clone: EPR16892), anti-calreticulin (rabbit polyclonal), and a rabbit isotype control (Abcam, UK). Additional stains included major histocompatibility complex (MHC) class I (clone: W6132; BioLegend, UK), CD80 (clone: 2D10; eBioscience, UK), FAS (rabbit polyclonal; Abcam, UK), and CD274 (PD-L1) (M1H2; BioLegend, UK). Relevant secondary Alexa 488-labeled antibodies were subsequently applied (Molecular Probes, UK). For the detection of murine markers on the TRAMP-C2 line, the additional following antibodies were used: anti-mouse H-2 (clone: M1/42; BioLegend, UK), anti-mouse CD80 (clone: 16-10A1; BioLegend, UK), and anti-mouse CD274 (PD-L1) (clone: M1H7; eBioscience, UK).
Released ATP and HMGB1 levels in cell supernatants of cell lines untreated, treated with reovirus, or exposed to heat-inactivated reovirus for 24, 48, and 72 h were detected using a standard ATP determination kit according to the manufacturer’s (Molecular Probes) instructions or measured by an HMGB1 ELISA (IBL International, Hamburg, Germany).

Annels N.E., Simpson G.R., Denyer M., Arif M., Coffey M., Melcher A., Harrington K., Vile R, & Pandha H. (2020). Oncolytic Reovirus-Mediated Recruitment of Early Innate Immune Responses Reverses Immunotherapy Resistance in Prostate Tumors. Molecular Therapy Oncolytics, 20, 434-446.

+ Open protocol

+ Expand

Immunocytochemistry Protocols for ER and Mitochondria

Cited 4 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Anti-TOM20 mouse monoclonal antibodies (Cat# ab56783, Abcam, and Cat# sc-17764, Santa Cruz Biotechnology), anti-Calnexin (Cat# ab22595, Abcam), and anti-Calreticulin (Cat# ab2907, Abcam) were used for immunocytochemistry experiments for 1:50–1:200. For immunostaining, Alexa Fluor 568 or 647 conjugated goat anti-mouse IgG (Cat# A-11004 and Cat# A-21236, Molecular Probes) and Alexa Fluor 647 conjugated goat anti-rabbit IgG (Cat# A-21244, Molecular Probes) were used as secondary antibodies for 1:200.
pT7-CalfluxVTN, which was a gift from Carl Johnson (Addgene plasmid # 83926)^{27 (link)}, was served as the template to design MAM-Calflux. A 173 aa N-terminal fragment of Venus domain of CalfluxVTN, VN173, was conjugated with a 103 aa linker and the ER-targeting sequence (mSac1 521–587 aa) at its C-terminus. A fragment containing the C-terminal part of Venus, VC155, and following Troponin C and NanoLuc domains was conjugated with the mitochondria-targeting sequence (mAkap1 1–30 aa) and a 57 aa linker at its N-terminus. Sec61b-mCherry was a gift from Gia Voeltz (Addgene plasmid # 49155)^{72 (link)}. pCMV R-CEPIA1er was a gift from Masamitsu Iino (Addgene plasmid # 58216)^{29 (link)}. The core sequence of human MFN2 shRNA was GGAAGAGCACCGTGATCAATG^{73 (link)}.

Cho E., Woo Y., Suh Y., Suh B.K., Kim S.J., Nhung T.T., Yoo J.Y., Nghi T.D., Lee S.B., Mun D.J, & Park S.K. (2023). Ratiometric measurement of MAM Ca2+ dynamics using a modified CalfluxVTN. Nature Communications, 14, 3586.

+ Open protocol

+ Expand

Profiling Antigen Presentation Machinery

Check if the same lab product or an alternative is used in the 5 most similar protocols

The protein concentration of each fraction was measured by a Bradford protein assay. An amount of 5 µg protein of each fraction was separated on 10% polyacrylamide gels at 40 mA per gel for 2 h and were blotted onto nitrocellulose membranes by semi-dry Western blot at 180 mA per membrane for 1 h. Membranes were blocked in 5% skim milk powder in TBS-T, incubated with the indicated primary antibody solution (in TBS-T supplemented with 5% BSA and 0.1% sodium azide) at 4 °C overnight followed by incubation with corresponding HRP-conjugated secondary antibody solution (in 3% BSA in TBS-T) at RT for 1 h. Proteins were visualized with ECL Detection Reagents (GE Healthcare, Chicago, IL, USA). The antibodies used were anti-beta Actin (MP, Irvine, CA, USA), anti-Tapasin, anti-beta2-Microglobulin, anti-ERp57, anti-Calreticulin (all Abcam, Cambridge, UK), anti-Yes (BD Bioscience), anti-Flotillin1, anti-Caveolin1 (Sigma-Aldrich, Seelze, Germany), anti-TAP1 (Novus Biologicals, Cambridge, UK), anti-TAP2 (MBL, Woburn, MA, USA), HRP-conjugated goat anti mouse and HRP-conjugated goat anti-rabbit (Thermo Scientific, Bonn, Germany).

Hoppmann N., Heinig N., Distler U., Kim E., Lennerz V., Krauß Y., Schumann U., Giese A., Tenzer S., Bitar L, & Schmidt M.H. (2022). Gamma Irradiation Triggers Immune Escape in Glioma-Propagating Cells. Cancers, 14(11), 2728.

+ Open protocol

+ Expand

Western Blot Analysis of Colon Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Colon tissues were lysed by using the Cell Lytic Buffer supplemented with both proteases (PIC, Merck) and phosphatases (NaF 10 mM; Na₃VO₄ 1 mM) inhibitors. Equal amounts of protein lysates (20 mg) were subjected to SDS-Page separation and proteins electroblotted onto Nitrocellulose (Merck) membranes. Non-fat 5% dry milk (Merck) in PBS was used as a blocking solution, and indicated primary antibodies, in blocking solution were incubated o.n. at 4 °C. Appropriate HRP-conjugated secondary antibodies were diluted in blocking solution (1:5000) and incubated for 1 h at r.t. A Westar ANTARES ECL kit (Cyanagen, Bologna, Italy) was then used and the signal acquired by a ChemiDoc^TM Touch (Bio-Rad), and analyzed using Image Lab software (5.0; Bio-Rad). Primary antibodies were as follows: anti-Bip/Grp78 (1:500; Santa Cruz, Dallas, TX, USA); anti-Calnexin (1:500; Santa Cruz); anti-Calreticulin (1:1000; Abcam, Cambridge, UK); anti-PARP cleaved (1:500; Cell Signaling, Danvers, MA, USA); anti-SLC7A11 (1:250; Cell Signaling); anti-Occludin (1:500; Cell Signaling); anti-Caspase-3 (1:250; Santa Cruz); anti-aActin (1:5000; Sigma, Darmstadt, Germany); anti-bTubulin (1:5000; Santa Cruz). HRP-conjugated secondary antibodies were diluted in blocking solution (1:5000; Jackson ImmunoResearch, Cambridgeshire, UK).

Monzani R., Gagliardi M., Clemente N., Saverio V., Pańczyszyn E., Santoro C., Yissachar N., Visciglia A., Pane M., Amoruso A, & Corazzari M. (2022). The Gut-Ex-Vivo System (GEVS) Is a Dynamic and Versatile Tool for the Study of DNBS-Induced IBD in BALB/C and C57BL/6 Mice, Highlighting the Protective Role of Probiotics. Biology, 11(11), 1574.

+ Open protocol

+ Expand

Quantification of UPR Pathway Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were lysed in 1X RIPA buffer (150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCl pH 7.5) plus 1% protease inhibitor cocktail, 1% PMSF (200 mM) and 1% sodium orthovanadate (Santa Cruz Biotechnology, USA). Lysates were clarified by centrifugation at 8000×g for 5 min at 4°C and equal amounts of protein were fractionated by SDS-PAGE and subsequently transferred onto nitrocellulose membrane, immunoblots were visualized using Supersignal® West Pico Chemiluminescent substrate (Thermo Scientific, Rockford, USA). Proteins were detected with anti-Glucose 6 Phosphate Dehydrogenase (Novus Biologicals, USA); anti-PERK (phospho T981) (#1055, Elabscience, Huston, USA); anti-PERK (#3667, Elabscience, Huston, USA); anti-IRE1 (phospho S724) (ab48187, Abcam, Cambridge, UK); anti-IRE1 (ab ab37073, Abcam, Cambridge, UK); Anti-eIF2α (phosphor S51) (9721, Cell Signaling, USA); anti-α-Tubulin Antibody (#2144 Cell Signalling Technology, UK); Anti-Calreticulin (ab2907, Abcam, Cambridge, UK); Anti-Calnexin (ab22595, Abcam, Cambridge, UK); Anti-BiP (BD610978, BD Biosciences, San Jose, CA); Anti-ATF4 (sc-200, Santa Cruz, Dallas, USA); Anti-Chop (sc7351, Santa Cruz, Dallas, USA); Anti-XBP1 (ab198999, Abcam, Cambridge, UK) and Anti-GAPDH (ab9485, Abcam, Cambridge, UK) were used for assessing loading.

Mele L., Paino F., Papaccio F., Regad T., Boocock D., Stiuso P., Lombardi A., Liccardo D., Aquino G., Barbieri A., Arra C., Coveney C., La Noce M., Papaccio G., Caraglia M., Tirino V, & Desiderio V. (2018). A new inhibitor of glucose-6-phosphate dehydrogenase blocks pentose phosphate pathway and suppresses malignant proliferation and metastasis in vivo. Cell Death & Disease, 9(5), 572.

+ Open protocol

+ Expand

Immunohistochemical Analysis of Excised Tumors

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gerber S., Uccello T., Lesch M., Kintzel S., Gradzewicz L., Lamrous L., Murphy S., Fleming F., Mills B., Murphy J., Hughson A., Garrett-Larsen J., Qiu H., Drage M., Ye J., Gavras N., Keeley D., Love T., Repasky E., Lord E, & Linehan D. (2023). New insights into the responder/nonresponder divide in rectal cancer: Damage-induced Type I IFNs dictate treatment efficacy and can be targeted to enhance radiotherapy. Research Square.

+ Open protocol

+ Expand

Immunohistochemical Analysis of Epilepsy Model

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of six rats, including three control rats and three rats from pilocarpine model of epilepsy group were used for the immunohistochemistry study. Rats were sacrificed under deep ketamine and xylazine anesthesia 4 h after the first observed seizure (3–5 stage) in chronic phase. 0.3% sodium sulphide in 0.1 M phosphate buffer (PB) was used to perfusion and 4% formaldehyde in phosphate buffer was used for fixation. The fixed brains were cryoprotected with 30% sucrose and cut using a freezing microtome at a thickness of 8 µm.
For immunohistochemistry staining, hippocampus coronal sections were treated with 0.5% Triton X-100 and 3% hydrogen peroxide for 10 min, and then with normal goat serum (1:10). The specimens were incubated with the primary antisera (anti-ADPRC1 from SANTA CRUZ Biotechnology, USA and anti-SNAP 25, anti-calreticulin and anti-PGP 9.5 from Abcam, USA) at room temperature overnight. After proper washing (3*5 min), slides incubated with anti-mouse and rabbit fluorescent secondary antibody for 2 h. After washing step nuclear staining has been done by DAPI. Slides were washed (3*2) and mounted properly for studding by fluorescent microscope.

Sadeghi L., Rizvanov A.A., Dabirmanesh B., Salafutdinov I.I., Sayyah M., Shojaei A., Zahiri J., Mirnajafi-Zadeh J., Khorsand B., Khajeh K, & Fathollahi Y. (2021). Proteomic profiling of the rat hippocampus from the kindling and pilocarpine models of epilepsy: potential targets in calcium regulatory network. Scientific Reports, 11, 8252.

+ Open protocol

+ Expand

Protein Detection Using Western Blot and Immunofluorescence

Check if the same lab product or an alternative is used in the 5 most similar protocols

For Western blot, primary antibodies were anti-LNP (rabbit, Sigma), anti-Flag (mouse, Sigma), anti-Myc (rabbit, Sigma) and anti-β-actin (mouse, Sigma). Secondary antibodies were goat anti-rabbit IgG-peroxidase antibody and goat anti-rabbit IgG-peroxidase antibody (Sigma).
For immunofluorescent staining, primary antibodies were anti-Flag (mouse, Sigma), anti-Myc (rabbit, Sigma), anti-Myc (mouse, Santa Cruz), and anti-calreticulin (rabbit, Abcam). Secondary antibodies were goat anti-rabbit IgG Alexa Fluor®555, donkey anti-mouse IgG Alexa Fluor®488, donkey anti-rabbit IgG Alexa Fluor®488 and donkey anti-mouse IgG Alexa Fluor®594 (Invitrogen).

Zhou X., He Y., Huang X., Guo Y., Li D, & Hu J. (2018). Reciprocal regulation between lunapark and atlastin facilitates ER three-way junction formation. Protein & Cell, 10(7), 510-525.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!