Mx3000p fluorescence quantitative pcr instrument

The reagents and equipment information used in this study are as follows: DMEM (Gibco, USA), Fetal Bovine Serum (Bioind, Israel), LipofectamineTM2000 (Invitrogen, USA), opti-MEM (Gibco, USA), Small Interfering RNA (Suzhou Gema Gene), N-acetyl-l-cysteine (Shanghai Biyuntian), TRIzol reagent (TaKaRa, Japan), Prime Script RT Reagent Ki reverse transcription instructions (TaKaRa, Japan), SYBG master mix dye (TaKaRa, Japan), 2,7-dichlorodihydrogen Fluorescein-acetoacetate (DCFH-DA) and 1uM dihydroethidium (DHE) (Shanghai Biyuntian Biotechnology Co., Ltd.), DAPI (Invitrogen, USA). Temperature incubator (Shanghai Jinghong Experimental Equipment Co., Ltd.), Mx3000P fluorescence quantitative PCR instrument (Agilent, USA).

Total RNA was extracted using TRIzol reagent (TaKaRa, Japan). RNA concentration was measured using UV spectrophotometer, and transcribe RNA was reversed into cDNA according to Prime Script RT Reagent Ki reverse transcription instructions (TaKaRa, Japan). SYBG master mix dye (TaKaRa, Japan) was prepared with cDNA and corresponding primers to form a reaction system (ice operation), which was fully mixed and briefly centrifuged. The Mx3000P fluorescence quantitative PCR instrument (Agilent, USA) was utilized for the subsequent reaction. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference gene. According to the manufacturer’s regulations, the standard curve was used to calculate the multiple relationship with Folds = 2^− ΔΔ CT representing the ploidy relationship between the expression of the target gene in the experimental group and the control group. Each experiment was repeated three times independently. (Table 2).Table 2

qRT-PCR primer sequences.

siRNA name	Sequence (5′-3′)
GAPDH	F: GTGGTGAACGGCCAGAAGAT
	R: GCCTTGTCAATGGTGGTGAA
CG8005	F: CTGGACTCGTGGTGGACATTCTG
	R: ACACTGAGTAATCCGCTCCATTGC

All primers were synthesized by Shanghai Sangon Industrial Co., Ltd.