Total RNA from Vero E6 or Calu-3 cells was extracted using TRIzol reagent (Thermo Fisher Scientific Inc, MA, USA) according to the manufacturer's instructions. Equal amounts of total RNA were reverse transcribed using the M-MLV reverse transcriptase system (Thermo Fisher Scientific Inc.) using random primers. Subsequently, qRT-PCR was performed with a QuantStudio3 RT-qPCR system (Applied Biosystems, Foster City, CA, USA) using primer pairs specific for the E gene. GAPDH was used as the internal control. The primer sequences are listed in Table S1 , and the relative mRNA expression was calculated using the 2−△△Ct method [13 (link)].
M mlv reverse transcriptase system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The M-MLV reverse transcriptase system is a laboratory tool used to synthesize complementary DNA (cDNA) from RNA templates. The core function of this system is to convert RNA into single-stranded cDNA, which can then be used for various downstream applications, such as gene expression analysis, cDNA library construction, and reverse transcription-polymerase chain reaction (RT-PCR).
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (9 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Quantstudio 3 rt qpcr system, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Rnalater, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Mirna first strand cdna synthesis kit, by Sangon (1 mentions)
Lightcycler 480 real time system, by Roche (1 mentions)
Miscript sybr green pcr kit, by Qiagen (1 mentions)
Rna stat 60 reagent, by Tel-Test (1 mentions)
Dnase, by Promega (1 mentions)
Quantstudio 6 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Mx3005p real time pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time rt pcr system, by Thermo Fisher Scientific (1 mentions)
16 protocols using m mlv reverse transcriptase system
1
Quantitative RT-PCR for SARS-CoV-2 E Gene
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First-strand cDNA was synthesized from 2 µg total RNA with primers for each gene. Briefly, 20 µl reverse transcription reaction mix was prepared using M-MLV Reverse Transcriptase system (Thermo Fisher Scientific, Inc.). cDNA was synthesized by incubating the reaction mix at 42˚C for 1 h and stored at -20˚C or used immediately. qPCR was performed using a 7500 Applied Biosystems RT-PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc. For each sample, a 20 µl reaction mixture consisting of 1 µl diluted cDNA (1:20), 5 pmol each of the forward and reverse primers, and 10 µl 2x SYBR Premix Ex Taq II (Takara Bio, Inc.). Expression in each sample was assessed in triplicate. Relative expression was calculated using the 2-ΔΔCq method (39 (link)).
3
Real-Time qPCR Analysis of mRNA and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HRECs or retinas using TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer's protocol, and 1 μg was reverse‐transcribed into complementary DNA (cDNA) using an M‐MLV Reverse Transcriptase System (Thermo Fisher Scientific). Real‐time qPCR was conducted in 10 μl total volume with SYBR Green Master Mix using a LightCycler 480 Real‐Time System (Roche, Mannheim, Germany). Cyclophilin A was used as an internal control. For miRNA detection, total cDNA was synthesized using an miRNA first strand cDNA synthesis kit (Sangon Biotech, Shanghai, China), and real‐time qPCR was performed using a miScript SYBR Green PCR Kit (Qiagen). U6 small nuclear RNA was used as an internal control. Specific sequences are listed in Table S1. Expression levels were quantified using the 2 − Δ Δ C t 2016 ).
4
RNA Extraction and qRT-PCR Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of cells and rat tissue was extracted with the RNA-STAT-60 reagent (Tel-Test, Inc., Friendswood, TX, USA). RNA yield was determined using a Nanodrop 2000 spectrophotometer (Thermo Scientific). Total RNA (1 μg) was reverse transcribed into cDNA using the M-MLV reverse transcriptase system (Thermo Scientific). PCR primers were described previously [19 (link), 26 ], except human TIMP2 (Sense: AAGCGGTCAGTGAGAAGGAA; Anti-sense: GATGTTCAAAGGGCCTGAGA), rat MMP2 (Sense: GTAAAGTATGGGAACGCTGATGGC; Anti-sense: CTTCTCAAAGTTGTACGTGGTGGA), and rat TIMP2 (Sense: ACACGCTTAGCATCACCCAGAA; Anti-sense: CAGTCCATCCAGAGGCACTCAT). Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was carried out on the Mx3005P Multiplex Quantitative PCR System with MxPro QPCR software (Stratagene, La Jolla, CA, US). Brilliant SYBR Green QPCR Master Mix (Stratagene) was used to perform PCR. GAPDH was used as an endogenous reference against which the different template values were normalized. All PCR reactions were performed in duplicate. The cycle of threshold (Ct) method was used for quantification. Data were analyzed by MxPro QPCR software.
5
SARS-CoV-2 E gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lung tissues were stored overnight in RNAlater (Thermo Fisher Scientific, Waltham, MA, USA) at 4 °C, homogenized using the bead-beating technology, and total RNA was subsequently extracted using the TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. After removal of genomic DNA with DNase (Promega, Madison, WI, USA), RNA samples were extracted with the phenol/chloroform method followed by ethanol precipitation. Equal amounts of total extracted RNA were subsequently reverse transcribed with the M-MLV reverse transcriptase system (Thermo Fisher Scientific) using random primers. Subsequently, qRT-PCR was performed on a QuantStudio3 RT-qPCR system (Applied Biosystems, Foster City, CA, USA) using the following primers specific for the E gene: forward 5′-ACA GGT ACG TTA ATA GTT AAT AGC GT-3′and reverse 5′-ATA TTG CAG TAC GCA CAC A-3’. The primers for hamster beta-actin, which served as internal control, were as follows: forward 5′-ACTG CCG CAT CCT CTT CCT-3′ and reverse 5′-TCG TTG CCA ATG GTG ATG AC-3′, whereas the sequence of the SARS-CoV2 E gene probe was 5’- [6FAM]ACA CTA GCC ATC CTT ACT GCG CTT CG[BHQ1]-3’. The relative mRNA expression was calculated with the 2−ΔCt method.
6
qRT-PCR for Gene Expression Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRI Reagent (Sigma-Aldrich) and quantified with NanoDrop spectrophotometer (Thermo Fisher Scientific). cDNA was generated with M-MLV reverse transcriptase system (Thermo Fisher Scientific) using 1 μg of total RNA as previously reported [27 ]. Gene expression was quantified using SYBR® Green PCR Master Mix in a QuantStudio 6 Real-Time PCR system (Thermo Fisher Scientific). Sequences and references for primers are listed in Additional Table 2 . Relative expression of mRNA was determined using the 2-(ΔΔCt) quantification method and normalized to YWHAZ as a reference gene [28 (link)].
7
RNA Extraction and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the RNeasy mini kit (Qiagen, Hilden, Germany, http://www.qiagen.com ) and reverse‐transcribed into cDNA with using the M‐MLV reverse transcriptase system (Thermo scientific). Brilliant SYBR Green QPCR Master Mix (Stratagene, La Jolla, CA, USA, http://www.genomics.agilent . com) was used to perform PCR. PCR primers used to amplify Oct4, Sox2, SMTN, ACTA1 and GAPDH are shown in Table 1 . GAPDH was used as an endogenous reference. Gene expression analysis was performed using Mx3005P Multiplex Quantitative PCR System with MxPro QPCR software (Stratagene, La Jolla, CA, USA). Samples were analysed in duplicate and their geometric mean calculated for normalization to the housekeeping GAPDH gene.
8
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Briefly, total RNA was extracted by using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. cDNAs were synthesised from 1 g of total RNA by using the Moloney murine leukaemia virus (M-MLV) reverse transcriptase system (ThermoFisher Scientific, Waltham, MA, USA). The cDNA was used for qRT-PCR (Ther-moFisher Scientific). All RT-PCR analyses were performed by using the Mx3005P Real-Time PCR System (ThermoFisher Scientific). For each condition, mRNA expression of biomarkers was quantified in duplicate. 18S rRNA was used as the endogenous control in the comparative cycle threshold (C T ) method. Gene expression was normalised to the expression of -actin, which was considered as the reference. Additional details about primer sequences, GenBank and Entrez gene accession, and amplification conditions are provided in supplementary material (Table 1).
9
Quantitative Analysis of Hypoxia-Induced Metabolic Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using isol-RNA lysis reagent (5 PRIME, CA, USA). cDNA way synthesized from total RNA by reverse transcription using an M-MLV reverse transcriptase system (Invitrogen, CA, USA), according to the manufacturer's instructions. Real-time polymerase chain reaction (PCR) was performed using a SYBR mix and a Rotor-Gene 6000 Real-Time Rotary Analyzer system (Corbett Life Science, Venlo, Netherlands). The following primer pairs were used: HIF-1α, 5′-CCA CCT ATG ACC TGC TTG GT-3′ (forward) and 5′-TAT CCA GGC TGT GTC GAC TG-3′ (reverse); LDHA, 5′-TGT GCC TGT ATG GAG TGG AA-3′ (forward) and 5′-AGC ACT CTC AAC CAC CTG CT-3′ (reverse); GLUT1, 5′-GCC CTG GAT GTC CTA TCT GA-3′ (forward) and 5′-CCC ACG ATG AAG TTT GAG GT-3′ (reverse); HK2, 5′-TAG GGC TTG AGA GCA CCT GT-3′ (forward) and 5′-CCA CAC CCA CTG TCA CTT TG-3′ (reverse); VEGF, 5′-CCT TGC TGC TCT ACC TCC AC-3′ (forward) and 5′-CAC ACA GGA TGG CTT GAA GA-3′ (reverse); and β-actin, 5′-GTC GTA CCA CTG GCA TTG TG-3′ (forward) and 5′-CTC TCA GCT GTG GTG GTG AA-3′ (reverse); PFK, 5′ -GAA GAG CCC TTC GAC ATC AG-3′ (forward) and 5′–TCT TCC TGC AGT CAA ACA CG -3′ (forward).
10
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRIzol (Invitrogen). After DNase I treatment, 1 μg of total RNA was reverse-transcribed using the M-MLV reverse transcriptase system (Invitrogen). Quantitative PCR was performed using the StepOnePlus Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) with the following specific primer pairs: BiP forward primer 5′-CTC AAC ATG GAT CTG TTC CG-3′ and reverse primer 5′-CCA GTT GCT GAA TCT TTG GA-3′ GAPDH forward primer 5′-TGC ACC ACC AAC TGC TTA GC-3′ and reverse primer 5′-GGC ATG GAC TGT GGT CAT GAG-3′. The target genes were then amplified under the following conditions: 50 °C for 2 min, 95 °C for 10 min, 50 cycles at 95 °C for 15 s and 60 °C for 1 min. To quantify the changes in target gene expression, the comparative Ct (ΔΔCt) method was used to calculate relative fold changes normalized to the GAPDH control. Data are expressed as the mean±s.d. and were analyzed with two-tailed Student's t-tests. P<0.05 was considered significant.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!