Trizol protocol

50 mg from frozen renal tissue (stored in RNA later™ solution, ThermoFisher) were processed with a Trizol protocol (93289, Sigma).and stored overnight at −80 °C. Total amount of RNA extracted, RNA integrity (RIN, RNAIntegrity Number) and purity (A260/A280) were measured by Nano Chip^® kit in Agilent 2100 Bioanalyzer (2100 expert software, Agilent Technologies, Walbronn, Germany) and ND-1000^® spectrophotometer (NanoDrop Tecnhologies, Wilmington, DE, USA), respectively. cDNA was synthesized using a Xpert cDNA Synthesis Mastermix (GK81.0100, Lot. 7E2709A, GRISP, Porto, Portugal) according to the manufacter’s instructions.
For each PCR reaction, 20 µL volume was used containing 2 µL of cDNA, 10 µL of Sybr Green (iTaq Universal SYBR Green Supermix 1725124, Bio-Rad, Hercules, CA, USA), 0.4 µL of each primer (listed in Table 1) and 7.6 µL of autoclaved DEPC water. Gene expression was normalized with GeNorm algorithm, where gene stability was attained with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and hypoxanthine-guanine phosphoribosyltransferase (HPRT). The relative expression ratio of each of the target gene was computed on the basis of ∆∆Ct (2^−∆∆Cp) values.

RNA isolation. Next generation sequencing of mRNA was performed on elutriated adult pachytene Ddx4:Cre;Dcr1^fx/fx mutant and control spermatocytes according to Illumina's protocol using 200 ng of RNA. Total RNA was isolated using the Trizol protocol (Sigma-Aldrich). Genomic DNA was removed by DNase treatment. RNA integrity was measured using an Agilent 2100 bioanalyzer and samples had RIN >7.0.
RNA-seq library preparation. 200 ng of RNA was used to isolate polyA + RNA using Sera-Mag oligo(dT) beads (Thermo Scientific), fragmented with an NEBNext kit (BioLabs). First-strand cDNA was synthesized with random primers using the Superscript II polymerase (Invitrogen). Second strand cDNA, end-repair, A-base addition, and ligation of the Illumina PCR adaptators were performed according to Illumina's protocol. Libraries were then selected for 100 bp cDNA fragments on a 3.5% agarose gel and PCR-amplified using Phusion DNA polymerase (Finnzymes) for 15–18 cycles. PCR products were then purified on a 2% agarose gel and gel-extracted. Each library was quality controlled (product size and concentration) by an Agilent 2100 bioanalyzer. Single-end libraries were sequenced as 100-mers on a Genome Analyzer II flowcell according to Illumina's protocol at a depth of ∼16.2–18.0 million reads per library.

The expression of VEGF and vascular endothelial cell marker CD31 were detected by rt-PCR. Total RNA was extracted using the TRIZOL protocol (Sigma-Aldrich, MO, USA), and then concentrated and purified according to the manufacturer’s instructions. RNA integrity was measured using agarose gel electrophoresis. A Prime-Script First-Strand cDNA synthesis kit (Takara, Dalian, China) was used for reverse transcription. A SYBR® premix Ex TaqTM kit (Takara) was used for PCR amplification. Real-time quantitative PCR was performed at 57 °C for 30 cycles in the Opticon continuous fluorescent detector using IQTM SYBR green supermix (BioRad, USA). Each group of samples was measured three times. 2 ^−△△CT was used to analyze the relative expression of each group of genes. Rat 18S ribosomal RNA was used as the internal reference. The primers used are set out in Table 1.Table 1

Primers for real-time PCR analysis

Gene	Forward Primer	Reverse Primer
VEGF	AGAAAGCCCATGAAGTGGTGA	GCTGGCTTTGGTGAGGTTTG
CD31	TTGTGACCAGTCTCCGAAGC	TGGCTGTTGGTTTCCACACT
Rat-18sRNA	GTAACCCGTTGAACCCCATT	CCATCCAATCGGTAGTAGCG