To extract total RNA, mycelia of each strain were cultured in glucose yeast extract peptone (GYEP) liquid medium (5% glucose, 0.1% yeast extract and 0.1% peptone) for 7 days shaking incubation in the dark at 28 °C. Total RNA was extracted using the RNAsimple Total RNA Kit (Tiangen Biotech, Beijing, China), and then used for reverse transcription with the HiScript Q Select RT SuperMix for qPCR kit (Vazyme Biotech, Nanjing, China). The expressions of FaTRI5 and FaTRI6 were determined by quantitative real-time PCR, and the relative quantification of each transcript was calculated by the 2-ΔΔCT method [24 (link)] with the F. asiaticum actin gene FaActin as the internal control. The experiment was repeated three times independently.
Hiscript q select rt supermix for qpcr kit
Manufactured by Vazyme
Sourced in China
HiScript Q Select RT SuperMix for qPCR kit is a reagent kit designed for reverse transcription and real-time PCR (qPCR). It contains essential components for cDNA synthesis and real-time PCR amplification in a single-tube format.
Automatically generated - may contain errors
Lab products found in correlation
Rnasimple total rna kit, by Tiangen Biotech (2 mentions)
Rt2 pcr real time sybr green rox pcr master mix, by Takara Bio (2 mentions)
Chamq sybr qpcr master mix kit, by Vazyme (1 mentions)
Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Gel doc ez imager, by Bio-Rad (1 mentions)
Rapid taq master mix, by Vazyme (1 mentions)
Sybr green master mix kit, by Vazyme (1 mentions)
Cfx96 pcr system, by Bio-Rad (1 mentions)
6 protocols using hiscript q select rt supermix for qpcr kit
1
Quantitative Analysis of FaTRI5 and FaTRI6
2
Quantification of Fusarium graminearum Mycotoxin Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA samples were isolated from vegetative hyphae of PH-1 and ∆Fgmon1 mutant cultured in liquid YEPD for 2 days, and used for cDNA synthesis with the HiScript Q Select RT SuperMix for qPCR kit (Vazyme Biotech, Nanjing, China) following the instructions. The RT2 PCR Real-Time SYBR Green/ROX PCR master mix (TaKaRa, Dalian, China) was used for qRT-PCR analysis. Primer pairs TRI5QF/TRI5QR and TRI6QF/TRI6QR13 (link) were used to amplify the TRI5 and TRI6 genes, respectively. The relative quantification of each transcript was calculated by the 2-ΔΔCT method49 (link) with the F. graminearum beta-tubulin gene TUB2 as the internal control. For each gene, qRT-PCR assay repeated three times with three biological replicates.
3
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA samples used in qPCR was the same as RNA-seq. Reverse transcription of mRNA to cDNA was operated according to the instructions of the HiScript Q Select RT SuperMix for qPCR kit (R123-01, Vazyme, Nanjing, China). The primers used for quantification in the study were designed using Primer 5.0, and β-actin was used as housekeeping gene. The sequences of primers are shown in Table S1 . The qPCR was conducted on the Applied Biosystems 7500 real-time PCR system (Applied Biosystems) using the ChamQ SYBR qPCR Master Mix kit (Q311-02; Vazyme, Nanjing, China). The relative expression of genes was calculated using the 2−ΔΔCT method.
4
Quantitative RT-PCR Analysis of M. oryzae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA samples were isolated from vegetative hyphae of Guy11 and the ΔMogls2 mutant cultured in liquid CM for 2 days, and used for cDNA synthesis with the HiScript Q Select RT SuperMix for qPCR kit (Vazyme Biotech, Nanjing, China) following the instructions. The RT2 PCR Real-Time SYBR Green/ROX PCR master mix (TaKaRa, Dalian, China) was used for qRT-PCR analysis. The relative quantification of each transcript was calculated by the 2-ΔΔCT method [26 (link)] with the M. oryzae ACTIN gene as the internal control. For each gene, qRT-PCR assay repeated three times with three biological replicates.
5
RNA Isolation and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the RNA simple Total RNA Kit (Tiangen Biotech, Beijing, China) and used as a template for cDNA synthesis with HiScript Q Select RT Super Mix for qPCR Kit (Vazyme Biotech, Nanjing, China). The synthesized cDNA was used as a template for gene amplification using primers and 2 � Rapid Taq Master Mix (Vazyme Biotech, Nanjing, China). Primer sequences are summarized in Table S1. PCR conditions are summarized in Table S2-S3. PCR products were separated by 1% agarose gel electrophoresis and observed on a gel doc ez imager (BIO-Rad, Shanghai, China).
6
Quantifying mRNA Expression Using qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the transfected cells after 48h using the TRIzol™ Reagent (Thermo Fisher Scienti c) under the instructions. The HiScript Q Select RT SuperMix for qPCR kit (vazyme, Nanjing, China) and SYBR Green Master Mix kit (vazyme, Nanjing, China) were utilized for cDNA synthesis and quantitative PCR, respectively. Real-time qPCR was performed in the BioRad CFX96 PCR system. The three genes primers used in the study were as follows, GGACTCATGACCACAGTCCA (GAPDH forward), TCAGCTCAGGGATGACCTTG (GAPDH reverse), AACCAGGGTCTGGATTGTGA (METTL3 forward), TCCAGTTGGGTTGCACATTG (METTL3 reverse), ACTTCGTGGTGGTGCTAAGA (RPS27A forward), and CCCAGCACCACATTCATCAG (RPS27A reverse). GAPDH was selected as an internal reference, and 2 -ΔΔCt was calculated to quantify the relative expressions of METTL3 and RPS27A.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!