Total RNA was prepared from murine whole hippocampus using the Ambion mirVana miRNA Isolation Kit (AM1560; Invitrogen, Waltham, MA) and quantified using the Agilent 2100 Bioanalyzer nanochip (Agilent Technologies, Santa Clara, CA). Mean RNA integrity number for the samples was 9.2 (SD 0.5). Sixty libraries were prepared using the Illumina TruSeq Stranded Total RNA with Ribo-Zero gold sample preparation kit (Illumina, Inc., San Diego, CA), using 500 ng of input total RNA. Libraries were run on the Agilent 2100 Bioanalyzer High Sensitivity kit (Agilent Technologies) and combined in equimolar concentrations into three pools based on index color balance. Concentration of pools was measured with the KAPA Illumina Library Quantification Kit (KAPA Biosystems, Wilmington, MA). Pools were sequenced on Illumina HiSeq 2000 and 2500 sequencers with 100-bp Paired-End v3 SBS chemistry (Illumina) at the Iowa Institute of Human Genetics.
Agilent 2100 bioanalyzer nanochip
Manufactured by Agilent Technologies
Sourced in United States
The Agilent 2100 Bioanalyzer nanochip is a microfluidic-based platform designed for the automated analysis of biological samples. It is used to separate, detect, and quantify various analytes, such as DNA, RNA, and proteins, in a small sample volume. The nanochip technology allows for rapid and accurate analysis of sample quality and concentration.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000 spectrophotometer, by Agilent Technologies (2 mentions)
Hiseq 2000 and 2500 sequencers, by Illumina (1 mentions)
Ambion mirvana mirna isolation kit, by Thermo Fisher Scientific (1 mentions)
Agilent 2100 bioanalyzer high sensitivity kit, by Agilent Technologies (1 mentions)
Truseq stranded total rna with ribo zero gold sample preparation kit, by Illumina (1 mentions)
Sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Rneasy extraction kit, by Qiagen (1 mentions)
Agilent 2100 bioanalyzer pico chip, by Agilent Technologies (1 mentions)
Hiseq 1500, by Illumina (1 mentions)
Qubit fluorometer, by Thermo Fisher Scientific (1 mentions)
Fragment analyzer automated ce system, by Agilent Technologies (1 mentions)
Truseq small rna library prep, by Illumina (1 mentions)
Truseq stranded mrna protocol, by Illumina (1 mentions)
Prism 7700 cycler, by Thermo Fisher Scientific (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Precellys 24, by Bertin Technologies (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
6 protocols using agilent 2100 bioanalyzer nanochip
1
Murine Hippocampus Transcriptome Profiling
2
Quantifying Beta-Catenin Expression in HCC1954 Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR was perfomed on an Applied Biosystems 7900HT thermocycler according to the manufacturer’s instructions. RNA was extracted from primary resected HCC1954 tumours (3 per group) using the Qiagen RNEasy extraction kit according to the manufacturer's instructions. The integrity of the RNA was measured on an Agilent 2100 bioanalyzer nano‐chip and samples with a RIN greater than 1.7 were converted to cDNA (1 μg––Superscript IV First strand synthesis system oligo‐DT Invitrogen) according to the manufactures instructions. Subsequently 1 μl of cDNA was subjected to qPCR. The primers for qPCR were self‐designed (www.Primer3.ut.ee ), and commercially synthesised by Sigma. Standard RT‐ qPCR (Sybr Green Master mix; Life Technologies) was used (max 40 cycles) to measure the expression of ctnnb1 with melt curve analysis to ensure primer optimization (Annealing temperature for primers:60°C. Range of CT values obtained for beta‐catenin 31.01–32.05. Range of CT values for RPLPO 20.03–20.27). Each sample and no template control were measured in triplicate. Relative expression was based on the 2‐ΔΔCT method. Expression was normalised to the expression of the housekeeper rplpo.
Primers ctnnb1 5′: GGCCATGGAACCAGACAGAA 3′: ACCCTCTGAGCTCGAGTCAT.
Primers rplp0 5′: CTGGAGAAACTGCTGCCTCA 3′: CAATGGTGCCCCTGGAGATT.
Primers ctnnb1 5′: GGCCATGGAACCAGACAGAA 3′: ACCCTCTGAGCTCGAGTCAT.
Primers rplp0 5′: CTGGAGAAACTGCTGCCTCA 3′: CAATGGTGCCCCTGGAGATT.
3
Molecular Profiling of Si-Induced Plant Responses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Roots inoculated with Si (Bd-Si) or mock-inoculated (Bd-C), as described above, were grown for 4 days and pooled (three roots per sample). Si mycelium and spores were collected from 4-week-old axenic cultures grown on CM medium. All samples in triplicates were shock frozen, stored at − 80 °C, and ground in liquid N2. Total RNA was isolated using the ZymoBIOMICS RNA Mini Kit (Zymo Research, USA), quantified with DropSense16/Xpose (BIOKÉ, Netherlands), and analyzed with an Agilent 2100 Bioanalyzer Nano Chip (Agilent, Germany). RNA Clean and Concentrator 25 and 5 kits (Zymo Research) were utilized to separate total RNA into fractions: 17–200 nt and > 200 nt. 1.5 μg of the larger fractions were processed for mRNA library preparation (TruSeq Stranded mRNA protocol, Illumina, USA). Fragment Analyzer Automated CE System (Advanced Analytical Technologies, Austria) determined the quality of the generated polyA mRNA libraries. Quantity and quality of the smaller RNA fractions were assessed with the Qubit fluorometer (Invitrogen, Germany) and Agilent 2100 Bioanalyzer Pico Chip. sRNA library preparation was done with 50 ng of RNA (TruSeq Small RNA Library Prep, Illumina) and size selection with the BluePippin (Sage Science, USA) for fragments between 140 and 160 nt (15–35 nt without adapters) applied. Sequencing was accomplished on the Illumina HiSeq 1500.
4
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The samples for RNA extraction were collected 24 h, three days, and seven days after the first injection of cae or saline. Total RNA was extracted using RNeasy Mini Kit (Qiagen, Basel, Switzerland), and tissue was homogenized using beads (Precellys® 24, Bertin Technologies, France). The RNA quality control was performed by microchip analysis Agilent 2100 Bioanalyzer (NanoChip, Agilent Technologies, Santa Clara, CA, United States) with a minimal required RIN of 7.0. Reverse transcription was performed according to the manufacturer's instructions, and 10 ng cDNA was added to Taq-Man Universal PCR master mix (Applied Biosystems) using a Prism 7700 cycler (Applied Biosystems, Foster City, CA, United States). The primers and probes used in this study not yet published[16 (link),17 (link),30 (link),31 (link)] are listed in Table 3 .
The mRNA expression of the gene of interest (GOI) relative to that of the housekeeping gene (HKG, 18S) was calculated by applying the Delta CT method (r = 2[Ct(HKG)-Ct(GOI)]).
The mRNA expression of the gene of interest (GOI) relative to that of the housekeeping gene (HKG, 18S) was calculated by applying the Delta CT method (r = 2[Ct(HKG)-Ct(GOI)]).
5
Transcriptome Analysis of Ginkgo sinensis Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The G. sinensis specimen used in the present study was wild-grown from the Jiangsu Province, China. Total RNA was extracted from four tissues: tender shoots, young leaves, flower buds, and round thorns, using TRIzol Reagent with qualification and quantification evaluated by Agilent 2100 Bioanalyzer Nanochips and NanoDrop 2000 Spectrophotometer. And then it was processed and used for Illumina sequencing [15 ].
Raw read sequences are uploaded in the Short Read Archive database from National Center for Biotechnology Information (NCBI) with the accession number SRR 1012862.
We used SeqPreq (https://github.com/jstjohn/SeqPrep ) to remove sequencing adapters and then used sickle [16 ] to trim low-quality sequences with default parameters. After cleaning reads, all of the high-quality reads were used in assembling by Trinity (trinityrnaseq_r2013-02-25) [17 , 18 (link)]. The k-mer was counted by jellyfish and the min_contig_length was set as 300. Then, RSEM [19 ] was used to measure expression levels of every unique transcript. Units of TPM (transcripts per million) were used to report results. After counting fraction of each isoform, length × isoform percent was defined as a standard to identify unigenes.
Raw read sequences are uploaded in the Short Read Archive database from National Center for Biotechnology Information (NCBI) with the accession number SRR 1012862.
We used SeqPreq (
6
Transcriptome Profiling of Ceropegia gigantea
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The samples were collected from the young roots, tender shoots, young leaves and flower buds of wild C. gigantea growing in Jiangsu Province. TRIzol reagent (Invitrogen) was used to extract the total RNAs (Hafner et al. 2008 (link)). Agilent 2100 Bioanalyzer Nanochips and NanoDrop 2000 Spectrophotometer (Agilent Technologies, Santa Clara, CA, USA) were then employed to evaluate the quality and quantity of the total RNAs (Kogenaru et al. 2012 (link)). The extracted total RNAs from the four tissues were mixed in equal and used in subsequent sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!