Biomix red pcr reaction mix

For RT-PCR, RNA was harvested using TRIzol reagent (Life technologies) following the manufacturer’s instructions, after which they were then digested using RQ1 RNase-free DNAse system (Promega). Reverse transcriptions were performed using the Reverse Transcription System (Promega) in accordance with the manufacturer’s instructions. PCR reactions were performed using BioMIx Red PCR reaction mix (Bioline) for GAPDH (forward – GAGTCAACGGATTTGGTCGT, reverse – TTGATTTTGGAGGGATCTCG), IE exon 2/3 (forward – GGACCCTGATAATCCTGACG, reverse – ATCTTTCTCGGGGTTCTCGT) and UL138 (forward – TGCGCATGTTTCTGAGCTAC, reverse – ACGGGTTTCAACAGATCGAC). PCRs were run for 35 to 45 cycles (95 °C for 45 s, 55 °C for 45 s, 72 °C for 1 min) with a long denaturing step before the cycles (95 °C for 10 minutes) and a long elongation step at the end (72 °C for 10 minutes). For RT-qPCR, RNA was isolated using RNeasy mini kit (Qiagen) before one-step RT-qPCR was performed using Quantitect Virus kit (Qiagen) as previously described80 (link).

RNA was extracted using commercial kits (GenElute Mammalian Total RNA Miniprep Kit; RNeasy Mini Kit, Qiagen, Manchester, UK; SideStep Lysis and Stabilization Buffer, Agilent Technologies, Wokingham, UK) and reverse transcribed using the High-Capacity cDNA Reverse Transcription kit (Life Technologies, Paisley, UK). Oligonucleotides and PrimeTime qPCR probes (Integrated DNA Technologies, Glasgow, UK) used for real-time RT-PCR are shown in Table 1. TaqMan assays for RNA polymerase II (RNAP) (POLR2A Hs00172187_m1) and Collagen Type 6A3 (COL6A3 Hs00915125_m1) were from Life Technologies. For real-time RT-PCR, relative gene expression levels were determined in cDNA samples using TaqMan Universal Master Mix (Life Technologies) and the ABI Prism 7900HT sequence detection system (Life Technologies). Expression levels were normalised to RNAP. Primers used for conventional real-time RT-PCR are shown in Table 2. For RT-PCR, cDNA was amplified using Bio-Mix Red PCR reaction mix (Bioline, London, UK) and analysed on 3.5% agarose gels stained with Gel-Red (Biotium, Cambridge Bioscience, Cambridge, UK) using β2-microglobulin (β2m) or 18S rRNA as a reference gene.