Psnap tag t7 2 vector

The bovine eIF4AI gene (GenBank accession no. 77735406) was synthesized by GenScript with the addition of an N-terminal FLAG tag and a C-terminal myc tag and cloned into pSNAP-tag (T7)-2 vector (New England BioLabs) using cut sites NdeI and NotI. Nucleotide sequences for 3C(wt), 3C(L127P), and 3C(C163A) with N-terminal FLAG tags were also cloned into pSNAP-tag (T7)-2 vector (New England BioLabs) using cut sites NdeI and NotI. Cell-free protein synthesis used a PURExpress in vitro protein synthesis kit (New England BioLabs) with the modification that two DNA plasmids were added in equimolar amounts. Western blots of cell-free synthesis products used anti-eIF4AI (ab31217, Abcam) antibody to detect eIF4AI and anti-DYKDDDDK (635691; TaKaRa) antibody to detect FLAG-tagged 3C.

The FLAG-3C(wt) gene was synthesized by GenScript and inserted into pSNAP-tag (T7)-2 vector (New England BioLabs) using restriction enzymes NdeI and XhoI as described above. To produce V28K, V141T, and C163A mutants, site-directed mutagenesis was performed using the primers and protocol described above. To produce L127P and C142T mutants, site-directed mutagenesis was performed as described above using the following primer sets: 3C L127P-MF (CCGACGTTGGGAGACCGATTTTCTCCGGTGA) and 3C L127P-MR (TCACCGGAGAAAATCGGTCTCCCAACGTCGG) as well as 3C C142T-MF (AAGGACATTGTAGTGACCATGGATGGAGACAC) and 3C C142T-MR (GTGTCTCCATCCATGGTCACTACAATGTCCTT), respectively. For construction of the pET O1P1-2A plasmid, a NotI restriction site was inserted into a Champion pET SUMO expression system (Thermo Fisher). The FMDV O1 Manisa P1-2A polypeptide gene was synthesized (GenScript) with flanking NheI and NotI restriction sites. The NheI and NotI restriction sites were used to insert the P1-2A gene into the modified pET SUMO plasmid, replacing the SUMO sequence.