We used the SuperScript IV One-Step RT-PCR System kit (Thermo Fisher Scientific) according to the manufacturer’s specifications. The RNA extracted from native and inactivated CPMV was reverse-transcribed and amplified into cDNA using the following reaction mixture: 2.5 μL forward primer (5′-GGTTCCCGCTTGCTTGGAGC-3′, 10 μM), 2.5 μL reverse primer (5′-GGAGGATTATAAATGTGCG-3′, 10 μM), 25 μL 2X Platinum SuperFi RT-PCR Master Mix, 0.5 μL SuperScript IV RT Mix, and 1 μg total RNA supplemented with nuclease-free water for a final volume of 50 μL. The RT-PCR conditions are summarized in Table 1 .
Superscript 4 one step rt pcr system kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The SuperScript IV One-Step RT-PCR System kit is a laboratory reagent designed for reverse transcription and polymerase chain reaction (RT-PCR) in a single reaction. It includes a thermostable reverse transcriptase enzyme and a DNA polymerase enzyme.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using superscript 4 one step rt pcr system kit
1
CPMV RNA Reverse Transcription and Amplification
2
Reverse Transcription-PCR of CPMV RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used the SuperScript IV One-Step RT-PCR System kit (Thermo Fisher Scientific) according to the manufacturer's specifications. The RNA extracted from native and inactivated CPMV was reverse-transcribed and amplified into cDNA using the following reaction mixture: 2.5 μL forward primer (5′-GGTTCCCGCTTGCTTGGAGC-3′, 10 μM), 2.5 μL reverse primer (5′-GGAGGATTATAAATGTGCG-3′, 10 μM), 25 μL 2X Platinum SuperFi RT-PCR Master Mix, 0.5 μL SuperScript IV RT Mix, and 1 μg total RNA supplemented with nuclease-free water for a final volume of 50 μL. The RT-PCR conditions are summarized in Table 1 .
3
IBDV Genome Amplification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two sets of primers that amplify the nearly complete genome of segments A and B of the IBDV, were designed and optimized. The primers designated as FA-5′ GATACGATCGGTCTGACCCC-3′ and RA-5′ TGGGATGTTGTATGGCCGAA 3′ (A) and FB-5′ GACCCTCTGGGAGTCACGAA and RB-5′ AGGCGAAGGCCGGGGATA 3′ (B) amplified 3,235 bp and 2,800 bp of segments A and B, respectively. The Superscript IV™ one-step RT-PCR system kit (Invitrogen, USA) was used according to the manufacturer's instructions. Briefly, 50 μL volume reaction mix was prepared from 25 μL of 2x platinum superFi™ RT-PCR master mix, 10 μM Forward Primer 2.5 μL (0.5 μM), 10 μM Reverse Primer 2.5 μL (0.5 μM), RNA template 2.5 μL, superscript IV™ RT mix 0.5 μL, and top up 17 μL nuclease-free water. The mixture was briefly centrifuged and ran under PCR cycling conditions: one cycle at 50°C for 10 min, 98°C for 2 min, and 35 cycles at 98°C for 10 s, 64.5°C for 10 s, and 72°C for 1.40 min and another cycle at 72°C for 5 min (segment A). For segment B, one cycle at 50°C for 10 min, 98°C for 2 min, and 40 cycles at 98°C for 10 s, 66°C for 10 s, and 72°C for 1.30 min, and another cycle at 72°C for 5 min. The PCR products were extracted using the QIAquick Gel Extraction kit (QIAGEN, Germany) according to the manufacturer's protocol, and the DNA proceeded to ethanol precipitation.
4
Quantification of Cardiac Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from LV using Direct-zol™ RNA Miniprep Plus TRIzol® Inc. RNA Out (Cat. No.: R2071), supplied by Zymo Research Corporation, Tustin, CA, USA). RNA was reverse-transcribed using the Invitrogen SuperScript™ IV One-Step RT-PCR System kit (Cat. No.: 12594100) supplied by Thermo Fisher Scientific, Waltham, MA, USA. The sequences of primers for miR-24-3p, RyR2, SERCA-2a and U6 and β-actin housekeeping genes are shown in Table 2 . The thermal cycler RT-PCR protocol was 1 cycle (10 min at 45 °C; reverse transcription), 1 cycle (2 min at 98 °C; RT inactivation and initial denaturation) and 40 cycles (10 s at 98 °C, 10 s at 55 °C and 30 s at 72 °C; amplification). Applied Biosystems StepOne™ Real-Time PCR system (Applied Biosystem, Waltham, MA, USA) was utilized. 2−∆∆Ct method was used to calculate the relative gene expression using the housekeeping gene U6 for miR-24 and β-actin for other genes.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!