For most RT-qPCR experiments, RNA was extracted using the RNeasy Mini Kit (Qiagen), reverse transcribed using Superscript II (Life Technologies) and random primers (Promega), and subjected to qPCR analysis, as previously described83 (link). To analyse major satellite and other repeat classes, total RNA was extracted using TRIzol (Life Technologies) and treated with two rounds of 1U DNase I (Fermentas) per 1 μg RNA in the presence of RiboLock RNase inhibitor (Fermentas) to remove genomic DNA. RNA (1 μg) was reverse transcribed using Superscript II (Life Technologies) and random primers (Promega), in the presence of RiboLock RNase inhibitor. cDNA was amplified with SYBR Green Jumpstart Taq Ready Mix (Sigma) using primers from84 (link),85 (link). Primer sequenced; Major Satellite For, GACGACTTGAAAAATGACGAAATC; Major Satellite Rev, CATATTCCAGGTCCTTCAGTGTGC; Minor Satellite For, TGATATACACTGTTCTACAAATCCCGTTTC; Minor Satellite Rev, ATCAATGAGTTACAATGAGAAACATGGAAA; LINE L1 For, CTGGCGAGGATGTGGAGAA; LINE L1 Rev, CCTGCAATCCCACCAACAAT; Nanog For, ATGCCTGCAGTTTTTCATCC; Nanog Rev, GAGGCAGGTCTTCAGAGGAA; Klf4 For, ACACTTGTGACTATGCAGGCTGTG; Klf4 Rev, TCCCAGTCACAGTGGTAAGGTTTC; Hmbs For, CGTGGGAACCAGCTCTCTGA; Hmbs Rev, GAGGCGGGTGTTGAGGTTTC; T For, TCAGCAAAGTCAAACTCACCAACA; T Rev, CCGAGGTTCATACTTATGCAAGGA.
Superscript 2
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, France, United Kingdom, China, Canada, Japan, Belgium, Australia, Switzerland, Netherlands, Italy, Spain, Denmark
Superscript II is a reverse transcriptase enzyme used for the synthesis of first-strand cDNA from mRNA templates. It is a modified version of the Moloney Murine Leukemia Virus (MMLV) reverse transcriptase, designed for improved performance and stability.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (555 mentions)
Trizol, by Thermo Fisher Scientific (399 mentions)
Rneasy mini kit, by Qiagen (266 mentions)
Rneasy kit, by Qiagen (122 mentions)
Dnase 1, by Thermo Fisher Scientific (120 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (102 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (78 mentions)
Sybr green master mix, by Thermo Fisher Scientific (70 mentions)
Lightcycler 480, by Roche (62 mentions)
Sybr green, by Thermo Fisher Scientific (56 mentions)
Random hexamer, by Thermo Fisher Scientific (52 mentions)
Rneasy plus mini kit, by Qiagen (47 mentions)
Nanodrop, by Thermo Fisher Scientific (46 mentions)
Random primer, by Thermo Fisher Scientific (45 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (45 mentions)
Turbo dnase, by Thermo Fisher Scientific (44 mentions)
Oligo dt primer, by Thermo Fisher Scientific (42 mentions)
Tri reagent, by Merck Group (42 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (39 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (37 mentions)
2 725 protocols using superscript 2
1
Comprehensive RNA Extraction and RT-qPCR Protocol
2
RT-qPCR Analysis of Satellite and Repeat RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For most RT-qPCR experiments, RNA was extracted using the RNeasy Mini Kit (Qiagen), reverse transcribed using Superscript II (Life Technologies) and random primers (Promega), and subjected to qPCR analysis, as previously described 72 . To analyse major satellite and other repeat classes, total RNA was extracted using TRIzol (Life Technologies) and treated with two rounds of 1U DNase I (Fermentas) per 1µg RNA in the presence of RiboLock RNase inhibitor (Fermentas) to remove genomic DNA. RNA (1µg) was reverse transcribed using Superscript II (Life Technologies) and random primers (Promega), in the presence of RiboLock RNase inhibitor. cDNA was amplified with SYBR Green Jumpstart Taq Ready Mix (Sigma) using primers from 73, 74
3
RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from sorted RANKK240E-expressing and wt B cells by using RNeasy Mini Kit (QIAGEN) according to the manufacturer’s instructions. RNA concentration of the samples was determined by NanoDrop. RNA was reverse transcribed using SuperScript II (Invitrogen) according to the manufacturer’s instructions using a 20-µl reaction of 100 ng to 1 µg total RNA, 0.5 mM deoxynucleotide triphosphates, 250 ng random primers, 5 mM DTT, and 10 U/µl of SuperScriptTM II. The generated cDNA was used in duplicates or triplicates for RT-PCR reactions, with primers that span exon–exon boundaries to ensure cDNA-specific amplification. The qPCR Core Kit for SYBR Green I (Roche) was used to perform RT-PCR. Gene expression patterns were normalized to the housekeeping gene, Actin. The reaction was performed in a Light Cycler 480 II (Roche) and analyzed for quality using melting curves.
4
RNA Extraction and RT-qPCR Analysis for ES Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from ES cells using the ReliaPrep miniprep kit (Promega), and reverse transcription was performed with SuperScript II (ThermoFisher Scientific) with oligodT oligos. For the MERVL and Zscan4 RT–qPCR analysis, total RNA was extracted from ES cells with the RNeasy Plus mini kit (Qiagen) and treated with turbo DNase (ThermoFisher Scientific) to remove genomic DNA. Reverse transcription was performed with SuperScript II (ThermoFisher Scientific) with random hexamers. Real‐time PCR was performed with Lightcycler 480 SYBR Green I Master Mix (Roche) on a LightCycler 96 Real‐time PCR System (Roche). The relative expression level was normalized to Gapdh and Actb (for MERVL, Zscan4, Dux, IAP and L1), and to Actb only (for RT–qPCR analysis of siRNA efficiency). Primers used in this study are described in Table 3 .
5
SARS-CoV-2 RNA Detection by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription was performed by mixing subject sample (4 µl in case of clinical nasopharyngeal swab sample), 1 µl 10 mM dNTPs, 0.15 µl 50 µM random hexamers (N8080127, Thermo), 0.1 µl RNase inhibitor (2313B, TaKaRa), 0.4 µl 0.5% Triton X-100 and RNase free water up to 4.5 µl, followed by incubation at 72 °C for 3 min. The sample was placed on ice and a mix containing 0.5 µl 100 mM DTT, 2 µl 5 M betaine, 0.1 µl 1 M MgCl2, 0.25 µl RNase inhibitor (2313B, TaKaRa), 2 µl 5x Superscript II buffer, 0.5 µl Superscript II (Invitrogen) and water up to 5.5 µl was added. The samples were then incubated at 25 °C for 10 min followed by 42 °C for 25 min and finally for 70 °C for 15 min. Amplification of 10 µl cDNA (RT mix) using primers and probes described in Table 1 was performed using BioTaq DNA polymerase (Bio-21040, Bioline) in a 20 µl reaction containing 2 µl 10x NH4 Reaction Buffer (Bioline), 1.2 µl 50 mM MgCl2, 0.2 µl 100 mM dNTP Mix and water up to 20 µl. The thermal cycling steps were: 25 °C for 2 min, 50 °C for 15 min, 95 °C for 2 min, and 45 cycles of 95 °C for 3 s and 56 °C for 30 s. qPCR was performed on a Step-One-Plus real time PCR machine (Applied Biosystems) using the StepOne Software v2.3.
6
Single-cell cDNA Synthesis and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA bound to the beads was processed further for cDNA conversion. This involved the resuspension of the beads in 10 μL of reverse transcriptase master mix (100 U of SuperScript II [Invitrogen], 10 U of RNasin [Promega], 1× SuperScript II first-strand buffer, 5 mM DTT [Invitrogen], 1 M betaine [Sigma], 9 mM MgCl2 [Invitrogen], 1 μM template-switching oligo [TSO; Eurogentec], 1 mM dNTP mix [Roche]). The mRNA mixture was reverse-transcribed by incubation for 60 min at 42°C followed by 30 min at 50°C and 10 min at 60°C. The cDNA obtained was subjected to PCR amplification by adding 11 μL of 2× KAPA HiFi HotStart ReadyMix and 1 μL of 2 μM ISPCR primer. The amplification was performed in a thermocycler for 3 min at 98°C, followed by 15 cycles of 15 sec at 98°C, 20 sec at 67°C, and 6 min at 72°C, and a final extension step of 5 min at 72°C. The amplified product was purified using Ampure XP beads with a 1:1 ratio and eluted into 20 μL of water. Libraries were prepared from 100–400 pg of cDNA using the Nextera XT kit (Illumina) following the manufacturer's instructions but with one-fifth volumes. All 96 single-cell RNA-seq libraries were pooled together and sequenced on an Illumina NextSeq platform to an average depth of 4.2 million reads using paired-end 75-bp read length settings.
7
Viral Genome Sequencing via Illumina HiSeq
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic viral RNA was isolated from twenty-two lineages (twenty-one evolved populations at the final passage [passage 25] plus the ancestor) using the QIAamp Viral RNA mini kit (Qiagen). All subsequent steps, from reverse transcription through sequencing, were completed in duplicate, resulting in two technical replicates of each sample. cDNA was generated by reverse-transcription with Superscript II (Life Technologies) using random hexamer primers. The majority of the genome sequence was amplified via PCR using eight primer pairs, generating overlapping PCR fragments 1–2.5 kb in length. Amplified genome fragments were purified using the QIAquick PCR Purification Kit (Qiagen), and the eight fragments from each virus population were combined to create an equimolar mixture. Libraries were prepared from the pooled viral amplicons using the Nextera XT Kit (Illumina Inc.) and the Nextera Index Kit (Illumina Inc.). Samples were sequenced via paired-end, 75-bp read Illumina HiSeq 2000 (Illumina Inc.) at the Yale Center for Genome Analysis. Quality control of reads was conducted using FastQC (Andrews 2010 ) with a minimum quality score of 20 and a minimum length of 30 bp.
8
Transcriptional Response of E. faecium to CHX Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
E. faecium 1,231,410 (E. faecium 410) and 1,141,733 cultures treated for 15 min with 0× (control) and 1× MIC CHX were harvested and mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen) according to the manufacturer's recommendations and a previously published protocol (24 (link)). Then, 100 ng RNA was used to synthesize cDNA with Superscript II (Life Technologies), and 5 ng cDNA was used as the template in RT-qPCR with primers to amplify internal regions of liaX or clpX. Threshold cycle (CT) values were used to calculate the fold change of liaX gene expression (normalized by clpX expression) between 1× MIC CHX-treated cultures and control cultures (n = 2 independent trials).
+ Expand
9
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Trizol reagent (Life Technologies) and 2 μg was reverse-transcribed using Superscript™II (Life Technologies) [22 (link)]. Real-time PCR was performed on a Mastercycler-ep-Realplex (Eppendorf) with primers specific to human and mouse genes (Supplementary Table S2 ) using Quantifast SYBR Green (Life Technologies). PCR was carried out according to the manufacturer's instructions. Melting curve analysis was used to verify that a single peak was obtained for each product with a 95–100% PCR efficiency (Roche software). Relative gene expression levels were normalized according to the Ct value of the housekeeping gene encoding the ribosomal protein L32 and results were expressed as fold differences equal to 2−ΔΔCt.
10
Transcriptome analysis of Hydra magnipapillata
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from whole animals of H. magnipapillata using the Trizol method (Life Technologies, Darmstadt, Germany). Oligo-dT primed first-strand cDNA synthesis was performed using SuperScript II reverse transcriptase (Life Technologies). Primers designed on H. magnipapillata sequence NW_002146487 (genebank), containing part of a TRP-N gene, were used to amp cDNAs by reverse transcription polymerase chain reaction (PCR). RACE (using 5′-RACE System; Life Technologies) was used to amplify 5′-exons. PCR fragments were PCR-amplified using GoTaq enzyme (Promega, Madison, WI), cloned with the pGEM-T vector system (Promega), and sequenced. Sequences obtained were used to identify additional genomic sequences coding for TRP-N genes. Assembly of full length open-reading frames for three additional genes was done accordingly. Results are provided online.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!