Cba mouse inflammation kit

Manufactured by BD

Sourced in United States, Germany

The CBA Mouse Inflammation Kit is a laboratory tool designed to measure the levels of specific inflammatory cytokines in mouse samples. It provides a multi-analyte quantitative assessment of these cytokines using flow cytometry technology.

Automatically generated - may contain errors

Lab products found in correlation

Facscanto 2, by BD (11 mentions) Fcap array software, by BD (8 mentions) Facscalibur flow cytometer, by BD (5 mentions) Accuri c6 flow cytometer, by BD (5 mentions) Facscalibur, by BD (5 mentions) Cba software, by BD (4 mentions) Facsverse, by BD (3 mentions) Pierce bca protein assay kit, by Thermo Fisher Scientific (2 mentions) Fcap array 3, by BD (2 mentions) Fcap array software version 3, by BD (2 mentions) Il 17, by R&D Systems (2 mentions) Cellquest pro, by BD (2 mentions) Complete protease inhibitor, by Roche (2 mentions) Cytoflex s, by Beckman Coulter (2 mentions) Facscanto 2 cytometer, by BD (2 mentions) Facsverse flow cytometer, by BD (2 mentions) Facsdiva software, by BD (2 mentions) Bca protein assay kit, by Thermo Fisher Scientific (2 mentions) Attune nxt, by Thermo Fisher Scientific (2 mentions) Cytometric bead array mouse inflammation kit, by BD (1 mentions)

Spelling variants of this product

CBA kit (111 citations) Mouse Inflammation Kit (52 citations) CBA) inflammation kit (7 citations)

134 protocols using cba mouse inflammation kit

Quantifying Tumor Immune Responses

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tumor tissues were harvested from mice treated with oncolytic Ad at 6 days after last viral treatment. MCP-1, IFN-γ, and TNF-α in tumor tissue extracts or serum (Supplementary Figure S3) were measured by cytometric bead array (CBA) mouse inflammation kits (BD Biosciences). Results were normalized to total protein concentration per tumor and calculated as picograms per milligram of total protein.
To measure IFN-γ and TNF-α released by tumor-specific immune cells, spleens were obtained aseptically from tumor-bearing mice at 6 days following last viral treatment. Unicellular splenocytes were prepared as previously described [19 (link)]. Prepared splenocytes (1.5 × 10⁶) were co-cultured with irradiated 4T1 (1.5 × 10⁵ cells; 5 Gy) for 2 days in the presence of recombinant mouse IL-2 (100 units/mL, R&D Systems). Culture supernatants were harvested and analyzed using CBA mouse inflammation kits (BD Biosciences).

Oh E., Choi I.K., Hong J, & Yun C.O. (2016). Oncolytic adenovirus coexpressing interleukin-12 and decorin overcomes Treg-mediated immunosuppression inducing potent antitumor effects in a weakly immunogenic tumor model. Oncotarget, 8(3), 4730-4746.

+ Open protocol

+ Expand

Multiplex Immunoassay for Cytokine Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

The serum concentrations of interleukin-6 (IL-6), IL-10, IL-12p70, interferon-γ (IFN-γ), TNF-α, and monocyte chemoattractant protein- (MCP-) 1 were measured with a bead-based multiplex immunoassay (BD CBA Mouse Inflammation Kit). Data were acquired with a FACSCalibur flow cytometer, with CellQuest software.

Wong-Baeza C., Tescucano A., Astudillo H., Reséndiz A., Landa C., España L., Serafín-López J., Estrada-García I., Estrada-Parra S., Flores-Romo L., Wong C, & Baeza I. (2015). Nonbilayer Phospholipid Arrangements Are Toll-Like Receptor-2/6 and TLR-4 Agonists and Trigger Inflammation in a Mouse Model Resembling Human Lupus. Journal of Immunology Research, 2015, 369462.

+ Open protocol

+ Expand

Cytokine and Nitric Oxide Analysis in Inflammatory Response

Check if the same lab product or an alternative is used in the 5 most similar protocols

The analysis of inflammatory mediators was performed in EV-stimulated macrophages, serum samples, and lung extracts of infected mice. Cytokines (IL-6, IL-10, IL-12p70, IFN-γ, TNF-α) and chemokine MCP-1 were evaluated using the BD™ CBA Mouse Inflammation Kit (BD Biosciences, San Diego, CA, USA). The results were measured by cytometry in a FACSCanto II (BD) and analyzed by the FCAP Array v3 program. The quantification in pg/ml was based on standard curves built with the kit control cytokines. Nitric oxide (NO) levels were assayed following the Griess colorimetric method (Green et al., 1982 (link)). The results were evaluated spectrophotometrically at 540 nm and the concentrations were calculated by comparison with a dose–response standard curve of NaNO₂.

Octaviano C.E., Abrantes N.E, & Puccia R. (2022). Extracellular Vesicles From Paracoccidioides brasiliensis Can Induce the Expression of Fungal Virulence Traits In Vitro and Enhance Infection in Mice. Frontiers in Cellular and Infection Microbiology, 12, 834653.

+ Open protocol

+ Expand

Quantitative Cytokine Profiling in Murine Sera

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse IgM and IgG levels were measured by quantifying serial dilutions of serum samples with an ELISA kit (quantification ELISA kit; Bethyl, Montgomery, TX, USA), according to the manufacturer’s instructions.
Inflammatory cytokines were measured in selected mouse sera by Cytometric Bead Array mouse inflammation Kit (BD reference 552364) using 1:5 dilution of serum. The BD CBA Mouse Inflammation Kit can be used to quantitatively measure IL-6, IL-10, monocyte chemoattractant protein-1 (MCP-1), IFN-γ, TNF, and IL-12p70 (IL-12p70) protein levels in a single sample. The kit performance has been optimized for analysis of specific proteins in tissue culture supernatants, EDTA plasma, and serum samples. The kit limit of detection provided by the manufacturer is 5 pg/mL for IL-6, 17.5 pg/mL for IL-10, 52.7 pg/mL for MCP-1, 2.5 pg/mL for IFN-γ, 7.3 pg/mL for TNF, and 10.7 pg/mL for IL-12p70.

Charrier S., Lagresle-Peyrou C., Poletti V., Rothe M., Cédrone G., Gjata B., Mavilio F., Fischer A., Schambach A., de Villartay J.P., Cavazzana M., Hacein-Bey-Abina S, & Galy A. (2019). Biosafety Studies of a Clinically Applicable Lentiviral Vector for the Gene Therapy of Artemis-SCID. Molecular Therapy. Methods & Clinical Development, 15, 232-245.

+ Open protocol

+ Expand

Skin Cytokine Extraction and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Circular punch samples of skin (6 mm in diameter) were homogenized using a tissue
homogenizer in 1 mL of ice-cold cytokine extraction buffer (0.4 M NaCl, 0.05% Tween 20,
0.5% bovine serum albumin, 0.1 mM phenylmethylsulfonyl fluoride, 10 mM EDTA, and 20 Ki of
aprotinin). The homogenates were centrifuged at 13,000×g for 10 min at 4°C, and
supernatants were stored at −80°C before analysis. Interleukin-17A (IL-17),
interferon-gamma (IFN-γ), and tumor necrosis factor-alpha (TNF-α) protein levels were
quantitatively measured by the BD CBA Mouse Inflammation Kit (BD Bioscience, San Diego,
CA, USA). The measurement was performed according to the manufacturer’s instructions. The
intensity of the fluorescence signal was acquired on an Accuri C6 flow cytometer and
analyzed using FCAP Array Software v3.0 (BD Biosciences).

Jalili R.B., Kilani R.T., Li Y., Khosravi-maharlooie M., Nabai L., Wang E.H., McElwee K.J, & Ghahary A. (2018). Fibroblast cell-based therapy prevents induction of alopecia areata in an experimental model. Cell Transplantation, 27(6), 994-1004.

+ Open protocol

+ Expand

Cytokine and Angiogenic Factors Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Concentrations of inflammatory proteins: IL-6, IL-10, IL-12p70, TNF, INFγ and MCP-1 in blood serum were measured using the cytometric BD™ CBA Mouse Inflammation kit according to the vendor’s instructions. BD FACSCalibur flow cytometer, BD CellQUEST and BD CBA software (BD Biosciences) were used for data acquisition. Levels of proangiogenic and immunomodulatory factor VEGF and KC were measured by colorimetric sandwich ELISA according to the manufacturer’s protocols. Results were normalized to total protein concentration.

Was H., Cichon T., Smolarczyk R., Lackowska B., Mazur-Bialy A., Mazur M., Szade A., Dominik P., Mazan M., Kotlinowski J., Zebzda A., Kusienicka A., Kieda C., Dulak J, & Jozkowicz A. (2020). Effect of Heme Oxygenase-1 on Melanoma Development in Mice—Role of Tumor-Infiltrating Immune Cells. Antioxidants, 9(12), 1223.

+ Open protocol

+ Expand

Quantification of Liver Th1 and Th17 Cytokines

Check if the same lab product or an alternative is used in the 5 most similar protocols

For liver Th1 and Th17 cytokines quantification, the BD™ CBA Mouse Inflammation Kit (552364, BD BioScience, New Jersey, USA) was used according to the manufacturer’s instructions.

Kou Y., Zheng X., Meng L., Liu M., Xu S., Jing Q., Zhang S., Wang H., Han J., Liu Z., Wei Y, & Wang Y. (2022). The HVEM-BTLA Immune Checkpoint Restrains Murine Chronic Cholestatic Liver Injury by Regulating the Gut Microbiota. Frontiers in Immunology, 13, 773341.

+ Open protocol

+ Expand

Cytotoxicity and Cytokine Profiling of PIP-CpG Treatments

Check if the same lab product or an alternative is used in the 5 most similar protocols

MMTV-PyMT cancer cells were seeded into a 96-well flat-bottom plate at 5,000 cells/well in 200 μL media (DMEM + 20% HI FBS + 1% P/S). The next day, media was removed and replaced with 200 μL fresh media containing the following treatments: PIP-CpG, PIP, CpG, GpC, PIP + CpG (mixed), or PIP + GpC (mixed), at 100 nM, 500 nM and 1000 nM. The GpC negative control sequence is 5ʹ - TGCAAGCTTGCAAGCTTGCAAGCTTGCAAT - 3ʹ (phosphorothioate bonds throughout the entire sequence) and was purchased from the Protein and Nucleic Acid (PAN) facility at Stanford University. After 24h incubation, 50 μL of the supernatant was immediately used to assess cytotoxicity using the Pierce LDH Cytotoxicity Assay Kit according to the manufacturer’s protocol. The remaining supernatant was frozen and stored overnight at −20°C. The next day, the supernatant was thawed and cytokine levels were analyzed using the BD CBA Mouse Inflammation Kit on a BD Accuri C6 Plus flow cytometer.

Miranda L.P, & Alewood P.F. (1999). Accelerated chemical synthesis of peptides and small proteins. Proceedings of the National Academy of Sciences of the United States of America, 96(4), 1181-1186.

+ Open protocol

+ Expand

Cytokine Profiling in Serum Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

The levels of IL-6, IL-10, IFN-γ, TNF and MCP-1 in serum samples were determined by cytometric bead arrays (BD CBA Mouse Inflammation Kit, USA), and the level of IL-1β in serum samples was determined by sandwich ELISAs (Abcam, USA) following the manufacturer’s protocol.

Hop H.T., Arayan L.T., Reyes A.W., Huy T.X., Min W.G., Lee H.J., Rhee M.H., Chang H.H, & Kim S. (2018). Heat-stress-modulated induction of NF-κB leads to brucellacidal pro-inflammatory defense against Brucella abortus infection in murine macrophages and in a mouse model. BMC Microbiology, 18, 44.

+ Open protocol

+ Expand

Multiplex Cytokine Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Supernatant was collected and immediately processed for Interleukin-6 (IL-6), interleukin-10 (IL-10), monocyte Chemoattractant protein-1 (MCP-1), and interferon-γ (IFN-γ) protein levels were quantitatively measured by BD CBA Mouse Inflammation Kit (BD Biosciences, San Jose, CA). The protocol was performed according to the manufacturer’s instructions. The intensity of fluorescence signal was acquired on a Beckman Coulter CyAn^ADP Flow cytometry operating with Summit v4.3 software for data collection. All further analysis was done with FlowJo (version 10.0.8; Software, Ashland, OR). Samples were run in biological triplicates with two technical duplicates.

Afzali M.F., Popichak K.A., Burton L.H., Klochak A.L., Wilson W.J., Safe S., Tjalkens R.B, & Legare M.E. (2018). A novel diindolylmethane analog, 1,1-bis(3′-indolyl)-1-(p-chlorophenyl) methane, inhibits the tumor necrosis factor-induced inflammatory response in primary murine synovial fibroblasts through a Nurr1-dependent mechanism. Molecular immunology, 101, 46-54.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!