Superscript 3 reagent

Total RNA was extracted using Trizol reagent (Life Technologies). SUV39H2 mRNA expression in ALL cell lines and primary cells was measured by the ViiA 7 system according to the manufacturer's instructions. Each cDNA was synthesized using SuperScript III reagents (Life Technologies) according to the manufacturer's instructions. qRT-PCR was performed using commercially available TaqMan Gene Expression Assay probes or Sigma-Aldrich SYBR Green probes with the ViiA 7 system (Life Technologies). The expression levels were normalized to B2M gene.

Cells were grown to 80% confluence in six-well culture dishes. RNA was purified after cell lysis using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) before preparing complimentary DNA using the Superscript III reagents (Thermo Fisher Scientific) or the RT2 First Strand kit (Qiagen). Samples were then analyzed by quantitative PCR, either with TaqMan probes (Life Technologies, BRD4, Hs04188087_m1; PGC-1α, Hs01016719_m1; HPRT1, 4326321E) or RT2 Custom Profiler Arrays (Qiagen, BRD4, PPH15694; PGC-1α, PPH00461; HPRT1, PPH01018; RPLP0, PPH21138; B2M, PPH01094). Ct values and fold-changes were determined from triplicate experiments using standard protocols. Relative quantification was performed after normalization to housekeeping genes.
For time course assays, CHL-1 and COLO-792 cells were treated with BAY 1238097 (1 μM) or JQ1 (1 μM) prior to harvest. For gene expression analysis of tumor samples, slices were homogenized and total RNA was extracted using the RNeasy Plus Mini Kit (Qiagen). Samples were analyzed using the TaqMan probes above, except for the murine B16F10 samples, which were analyzed with mouse-specific TaqMan probes: PGC-1α, Mm01208835_m1; HPRT1, Mm03024075_m1. Gene expression profiles of PDX models were determined by Affymetrix Inc. Technology (Lahr, Germany).

Seventy-two hours after the magnetofection of different concentrations of PEI-SPIONs (0, 1, 2, 4, and 8 μg/mL) to SCs, the SCs were first counted and then homogenized in Trizol reagent (Sigma-Aldrich). Total RNA was isolated and normalized to cell numbers. cDNA was synthesized using Superscript III reagents (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis was then performed. The sequence of primers for PST 5′ to 3′ was upper: GAAAAGAAACCCGAGCCCCA; lower: AGGCTCCGTTTTGGGGAAAT. The qRT-PCR parameters used were denaturation at 95°C, 30 s; primer annealing at 59°C, 30 s; and elongation products at 72°C, 40 s. Acquired PCR products were quantified using the 2-ΔΔCt method. The housekeeping gene ACTB was used to normalize quantities of messenger RNA (mRNA). Assays were performed three times.