Revertaid

Total RNA was isolated from primary microglia using TRIzol reagent (Invitrogen, Karlsruhe, Germany) according to manufacturer’s instructions. RNAs from SN and caudate putamen (CPu) were isolated after dissection and transfer to RNA later (Ambion). Tissues were homogenized in peqGOLD TriFast (PeqLab) using a Precellys 24 homogenizer (PeqLab). RNA concentration and quality was determined using the NanoDrop 2000 (Thermo Scientific, Germany). 1 μg RNA from each sample was reverse transcribed to cDNA using RevertAid (Fermentas, St. Leon-Rot, Germany) according to the manufacturer’s instructions.

For validation of results from RNA-seq, qRT-PCR was performed using the BioMark system (Fluidigm) as according to the two-step single-cell gene expression protocol using EvaGreen as described in the Real-Time PCR Analysis User Guide (PN 68000088, Fluidigm). For the process, 666 ng of starting RNA was used for each sample, which underwent 18 cycles of specific target amplification (STA) followed by a tenfold dilution. SCN CT values were normalised using the housekeeping genes ActB, Gapdh and eight genes which showed the most stable expression in the SCN according to sequencing data (Ankrd40, Nkiras1, Sar1a, Smarce1, Snrpn, Tpgs2, Tsn and Ywhaz). Primer sequences are listed in Supplementary file 1.
For RT-PCR of novel exons of Cry1, total RNA was purified from dissected SCN tissue and used to prepare cDNA (Revertaid, Fermentas). Primers representing previously annotated (5’ GTGAGGAGGTTTTCTTGGAAG 3’) and novel (5’ CTTCTAGGGAATTGCGACTG 3’) exons were used with a common reverse primer (5’ CTGGGAAATACATCAGCTGG 3’) to amplify products by RT-PCR followed by visualisation on an agarose gel and sequencing. The genomic coordinates of the novel exon are: chr10: 85,183,342 to 85,183,832 (mm10) with splicing into the following exon at 85,183,342 or 85,183,510.

Total RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA), as described by the manufacturer. mRNA was reverse transcribed with RevertAid (MBI Fermentas, Inc., Burlington, ON, Canada) at 42°C for 60 min, and the resulting cDNA was subjected to PCR (94°C for 1 min followed by 20–25 cycles at 94°C for 30 sec, 60°C for 30 sec, 68°C for 1 min and an extension for 10 min at 68°C). The PCR products were separated on 1.0% agarose gels and visualized with ethidium bromide. The forward (F) and reverse (R) primer pairs are listed (5′ to 3′) as follows: VEGF-F, CCTGGTGGACATCTTCCAGGAGTACC and VEGF-R, GAAGCTCATCTCTCCTATGTGCTGGC; Flt-1-F, CGGGATCCAAGGGACTCTACACTTGTC and Flt-1-R, GGAATTCCCGAATAGCGAGCAGATTT; Flk-1-F, CATTGTGTCCTGCATCCGGGATAACCT and Flk-1-R, TGTACACGATGCCATGCTCGTCACTGA; 18S-RNA-F, GCCCGAAGCGTTTACTTTGAA and 18S-RNA-R, GGTGAGGTTTCCCGTGTTGA. The quantification of gene expression was performed by Imagepro-plus 6.0 software, and the intensity values were normalized to 18S RNA.

Real-time (TaqMan) primers and probes were designed using Primer Express 2 with sequences from GenBank and derived from the sequencing in this study when available (Applied Biosystems). Real-time RT-PCR was performed on previously extracted RNA in 96 well plates on an ABI 7900 instrument (Applied Biosystems). Reactions consisted of 1× buffer A (Applied Biosystems), 0.2 mM of each dNTP, 5.5 mM MgCl₂, 0.025 U/µl AmpliTaq Gold (Applied Biosystems), 0.4 U/µl Revertaid (Fermentas), 300 nM of each primer, 100 nM of probe and 1 µl of extracted RNA (concentration as extracted) to give a final reaction volume of 25 µl. The cycling conditions used were: 30 min at 48°C, 10 min at 95°C, then 40 times, 15 sec at 95°C and 1 min at 60°C. Negative controls consisted of water replacing the template. Results were scored as positive or negative for CYLV based on presence or absence of amplification after 40 cycles.

RNA was extracted using an RNeasy MinElute Cleanup kit (Qiagen). Isolated RNA was then subjected to DNAse treatment (Turbo-DNA free, Ambion). Reverse transcription was carried out using random hexamer primers and RevertAid reverse transcriptase (Fermentas). Quantitative real-time PCR was performed employing the KAPA SYBR FAST ABI Prism (Peqlab). Analysis was carried out in triplicates, using GAPDH as a control gene.

Guanidine thiocyanate (GTC) was used to extract total RNA from BMMCs and BMDMs38 (link). RNA was reverse transcribed by M-MuLV reverse transcriptase (RevertAid, MBI Fermentas) and used for quantitative analysis of mouse genes (Supplemental Table 1) with an ABI PRISM 7700 Taqman apparatus (Applied Biosystems). Murine hypoxanthine phosphoribosyltransferase (HPRT) and murine ribosomal protein 27 (RPL27) were used as standard housekeeping genes.

A comparison of the human and mouse cDNA sequences showed that the mouse Tcf20 transcript contains an extra exon encoding an extended 5′ untranslated region (UTR).27 (link) Correspondingly, comparison of the human and mouse genomic sequence revealed a highly conserved region ∼68.5 kb telomeric of the first annotated exon of TCF20 in the human genome. We isolated total RNA from normal human transformed B-lymphocytes and generated cDNA using random hexamer primers (RevertAid, Fermentas). Following amplification using cDNA as template with primers in the large exon of TCF20 and the conserved region (primer pair 5′-TCCTCCCCCGCCTCGGCTCAG -3′ and 5′-CACTGCTGCCACTACTGCCACCTGTAC-3′), we found the conserved region to be spliced to the previously identified exon 1 of TCF20, indicating that this region represents a previously unannotated exon of human TCF20 (GenBank KF851355).