After treatment, cells were harvested, total RNA was extracted using TRIzol reagent (TakaraBio, Dalian, Japan), and cDNA was generated from 1 μg RNA using the Prime-Script RT reagent kit (Takara) according to the manufacturer's instructions. cDNA was used for quantitative RT-PCR using a Taq PCR Master Mix kit (Takara) and conducted on the StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using RT Reaction Mix in a total volume of 20 μL at 95°C for 30 s, followed by 95°C for 5 s, and 60°C for 30 s for 40 cycles. The primer sequences were as follows: ZO-1 (Takara): 5′-GACCAATAGCTGATGTTGCCAGAG-3′ and 5′-TGCAGGCGAATAATGCCAGA-3′; NEP (Takara): 5′-TAAGCAGCCTCAGCCGAACC-3′ and 5′-TTGACATAGTTTGCACAACGTCTCC-3′; and GAPDH (Takara): 5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′. GAPDH was used to normalize target gene mRNA levels, which were analysed using the 2−ΔΔCt method.
Gapdh
Manufactured by Takara Bio
Sourced in Japan, China, United States
GAPDH is a crucial enzyme involved in the glycolysis pathway. It catalyzes the oxidative phosphorylation of glyceraldehyde-3-phosphate to 1,3-bisphosphoglycerate, a key step in energy production within cells.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (14 mentions)
All in one qpcr mix, by Takara Bio (6 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Trizol reagent, by Takara Bio (4 mentions)
Primescript rt reagent kit, by Takara Bio (4 mentions)
Rneasy plus mini kit, by Thermo Fisher Scientific (4 mentions)
Primescript rt master mix kit, by Takara Bio (4 mentions)
M mlv reverse transcriptase, by Takara Bio (2 mentions)
Reverse transcription kit, by Takara Bio (2 mentions)
Gapdh, by OriGene (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Fast sybr green real time pcr mixture, by Thermo Fisher Scientific (2 mentions)
Abi stepone real time pcr system, by Thermo Fisher Scientific (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
M mlv reverse transcriptase, by Promega (2 mentions)
Primescript rt master mix, by Takara Bio (2 mentions)
Sybr premix ex taq 2, by Takara Bio (2 mentions)
Interleukin 6 (il 6), by Takara Bio (2 mentions)
Trizol, by Takara Bio (2 mentions)
50 protocols using gapdh
1
Quantitative RT-PCR Analysis of Gene Expression
2
Quantifying TRPC1 Expression in Lung Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TRPC1 transcript levels were measured by real-time PCR. The PCR primers for TRPC1 were designed as follows: TRPC1 forward, 5′-GCCAGTTTTGTCACTTTGTTATTT-3′; TRPC1 reverse, 5′-CCCATTGTGTTTTTCTTATCCTCA-3′; GAPDH forward, 5′-CGCTGAGTACGTCGTGGAGTC-3′; and GAPDH reverse, 5′-GCTGATGATCTTGAGGCTGTTGTC-3′ (TaKaRa Biotechnology, Japan).
The pulmonary tissues were maintained in formalin, routinely processed, and embedded in paraffin. TRPC1 expression was assessed according to immunohistochemical methods [33 (link)]. The rabbit anti-TRPC1 polyclonal antibody was diluted 1:25.
Frozen bronchial tissue was homogenized in 200 mL of RIPA lysis buffer containing protease inhibitors. This mixture was then centrifuged. The supernatants of A group were used for ELISA (ELISA kit (R&D systems, USA)) and the supernatants of of B group were used for western blot analysis (1:1000; Abcam, USA) [26 (link)], GAPDH was used by 1:1000 (Beyotime, China).
The pulmonary tissues were maintained in formalin, routinely processed, and embedded in paraffin. TRPC1 expression was assessed according to immunohistochemical methods [33 (link)]. The rabbit anti-TRPC1 polyclonal antibody was diluted 1:25.
Frozen bronchial tissue was homogenized in 200 mL of RIPA lysis buffer containing protease inhibitors. This mixture was then centrifuged. The supernatants of A group were used for ELISA (ELISA kit (R&D systems, USA)) and the supernatants of of B group were used for western blot analysis (1:1000; Abcam, USA) [26 (link)], GAPDH was used by 1:1000 (Beyotime, China).
3
Quantifying RNA Methylation Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from SAP and control groups as described above. qPCR was performed using One Step SYBR® PrimeScript™ RT-PCR kit II (Takara Biotechnology Co., Ltd., Dalian, China) and the primers (ALKBH5: forward 5’-GGCGGTCATCATTCTCAGGAAGAC-3’ and reverse 5’-CTGACAGGCGATCTGAAGCATAGC-3’; FTO: forward 5’-CTCACAGCC TCGGTTTAGTTCCAC-3’ and reverse 5’–CGTCGCCATCGTCTGAGTCATT G-3’; GAPDH: forward 5’-GGTGAAGGTCGGTGTGAACG-3’ and reverse 5’-CTCGCTCCTGGAAGATGGTG-3’) were synthesized by Shanghai Sangon Biotech Co., Ltd.. The outcomes were analyzed by means of 2-ΔΔCT through normalizing the quantity of GAPDH.
4
Quantitative Real-Time PCR Workflow
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolation of Total RNA and cDNA was executed conforming to the instructions of the manufacturer. 20 μL reaction volume of the All-in-one qPCR Mix (TaKaRa Bio Inc) includes 1 μL of cDNA, 10 μL of 2×All-in-one qPCR Mix (TaKaRa Bio Inc), 1 μL of 2 mmol/L reverse primers, 1 μL of 2 mmol/L forward primers, and 6 μL of nuclease-free water. Denaturation at 95° C for 10 minutes, succeeded by 40 cycles of 10 seconds at 95° C, 20 seconds at 60° C, and 15 seconds at 72° C. The primers of Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, TaKaRa Bio Inc) were utilized for the estimation of the amount of GAPDH cDNA in each sample for normalization. Table 1 lists the primers employed in this research. Determination of the comparative fold-change in the target gene cDNA was carried out via the use of the 2−ΔΔCt approach.
5
Quantification of Gene Expression in Rat Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from rat monocyte-derived macrophages using RNeasy Plus Mini Kit (Invitrogen Co, USA) according to the manufacturer's instructions, and cDNA was generated through reverse transcription using the PrimeScript RT Master Mix kit (TaKaRa Bio Inc, Japan). Equal amounts of cDNA were diluted and ampli ed through real-time polymerase chain reaction (PCR) using All-in-one qPCR Mix (TaKaRa Bio Inc) in a 20 µl reaction volume containing 10 µl of 2×All-in-one qPCR Mix (TaKaRa Bio Inc), 1 µl of 2 mmol/L forward primer, 1 µl of 2 mmol/L reverse primer, 1 µl of cDNA, and 6 µl of nuclease-free water. After an initial denaturation step for 10 min at 95°C, the conditions for cycling were 40 cycles of 10 s at 95°C, 20 s at 60°C, and 15 s at 72°C. For the normalization of each sample, glyceraldehyde 3phosphate dehydrogenase (GAPDH, TaKaRa Bio Inc) primers were used to measure the amount of GAPDH cDNA. The primers used are listed below (Table 1). Relative expression levels of mRNA, lncRNA, and miRNA was determined using the 2 -ΔΔCt method [14] . Relative MEG8 and miR-181a-5p expression were normalized to 18S and the mRNA level of SHP2 was normalized to GAPDH.
6
Quantification of Clec4d Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Template for RT PCR was a commercial tissue cDNA panel (Clontech). For bone marrow, blood, and peritoneal macrophages, mRNA was isolated using TRI reagent (Applied Biosystems) and RNeasy kit (Qiagen), followed by cDNA synthesis with SuperScript III First‐Strand SuperMix (Invitrogen) according to manufacturers’ instructions. Clec4d mRNA expression was analyzed using standard PCR protocols with primers mClec4d_F (5’AGGTACTTGGACCTGCTGTCCTGTAGC), mClec4d_R (5’TCCCCCTTTTCCCAGAATACCGTGTG), and Clontech GAPDH or mGAPDH_F (5’CCAGGTTGTCTCCTGCGACTT) and mGAPDH_R (5’CCTGTTGCTGTAGCCGTATTCA) primers.
7
Analyzing Gene Expression in Murine Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissues (brain, bone, lung, liver) were harvested from 6 month old male mice or 5 day old littermates (rib cartilage) and homogenized using a tissue grinder. For bone, whole tissue including matrix, bone marrow and periosteum was processed for RNA extraction. Total RNA was extracted using Trizol reagent and RNA was purified using an RNeasy micro kit (Qiagen) according to the RNeasy cleanup protocol. cDNA was synthesized from 1 µg of RNA using MMLV reverse transcriptase and Oligo(dT)18 as primers (Clontech). PCR was performed using Spon1 specific primers AGAGGCACCGTATGGTCAAG (forward) and GACCACTCGCTGAGTTCACA (reverse). Gapdh (Clontech, #ST0253) was used as a housekeeping control. After amplification, products were resolved on a 1% agarose gel and visualized by ethidium bromide staining.
8
RT-PCR-based 10A RNA Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using the RT-PCR one-step script Super kit (Bioneer, South Korea) and suitable primers, the amount of 10A RNA was converted into cDNA (Complementary DNA). The primers used for GAPDH (Glyceraldehyde P-phosphate dehydrogenase) (Clontech) were used as the housekeeping gene (control). The obtained product had a single and specific band in agarose gel electrophoresis.
9
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted using TRIzol reagent (Invitrogen Inc., Carlsbad, CA, United States). Reverse transcription of miRNA was performed using a transcription kit (Shanghai GeneChem Co., Ltd., Shanghai, China) with RNA U6 as an internal control. mRNA was detected using a reverse transcription kit (Takara Biotechnology Ltd., Dalian, Liaoning, China) with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sequence as an internal reference for the normalization of RT-PCR. SYBR Green quantitative PCR analysis was performed using a 7500 real-time fluorescence quantitative PCR system.
The expression levels of target genes were then estimated using the 2−ΔΔCT method. 17 (link)
, 18 (link)
Primers STAT1 (#HP210040), JAK2 (#HP208201), IRF-1 (HP205934), PD-L1 (#HP210654), IFN-γ (#HP200586), NF-κB (#HP207409), Bcl-xL (#HP234144), COX-2 (#HP200900), GAPDH (#HP205798), and β-catenin (#KN208947) were purchased from OriGene Technologies (Beijing, China).
The sequence of primers is presented intable 1 .
The expression levels of target genes were then estimated using the 2−ΔΔCT method. 17 (link)
, 18 (link)
Primers STAT1 (#HP210040), JAK2 (#HP208201), IRF-1 (HP205934), PD-L1 (#HP210654), IFN-γ (#HP200586), NF-κB (#HP207409), Bcl-xL (#HP234144), COX-2 (#HP200900), GAPDH (#HP205798), and β-catenin (#KN208947) were purchased from OriGene Technologies (Beijing, China).
The sequence of primers is presented in
10
Quantitative RT-PCR Analysis of Cardiac Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNAs were extracted from ventricular tissues or cell lysates using RNeasy Mini kits (Qiagen, Cat. No. 74104, Hilden, Germany). Reverse transcription was performed using an iScript cDNA synthesis kit (Bio Rad, Cat. No. 1708891, Hercules, CA, USA). PCR reactions were performed with an ABI Step One Real-Time PCR System (Applied Biosystems, Quant Studio3, Foster, CA, USA) using Fast SYBR Green Real-time PCR Mixture (Applied Biosystems, Cat. No. 4385612, Foster, CA, USA) [52 (link)]. Primers for CTGF (Takara Bio Inc. Cat. No. MA028643), TGF-β (Takara Bio Inc. Cat. No. MA122075), collagen I (Takara Bio Inc. Cat. No. MA128559), collagen III (Takara Bio Inc. Cat. No. MA126692), OPN (Takara Bio Inc. Cat. No. MA114392) (Takara Bio Inc. Cat. No. HA201672), MCP-1 (Takara Bio Inc. Cat. No. MA066003), HGF (Takara Bio Inc. Cat. No. MA105799), and 18S ribosomal RNA (18S) (Takara Bio Inc. Cat. No. MA050364) and Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Takara Bio Inc. Cat. No. HA067812) are available commercially. The mouse heart samples were normalized to values for 18s mRNA expression (ΔΔCT method). The human cardiomyocyte culture samples were normalized to values for GAPDH mRNA expression (ΔΔCT method).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!