Fetal bovine serum (fbs)

Mouse embryonic fibroblasts (MEFs) were derived from embryonic day 13.5 C57BL/6 mouse embryos. MEFs were incubated in DMEM/high glucose (Hyclone) with 10% fetal bovine serum (FBS) (Natocor) supplemented with 1% nonessential amino acids (NEAA, Gibco). C57BL/6 mouse embryonic stem cells (Biocytogen) were seeded into 12-well plate containing feeder layers in ES medium with DMEM/high glucose, 15% FBS (Gibco), 1% NEAA, 1% GlutaMAX (Gibco), 1% Sodium Pyruvate (Gibco), 0.1 mM β-mercaptoethanol (Gibco), 1 μM PD0325901 (Selleck), 3 μM Chir99021 (Selleck) and 1000 U/mL LIF. The OP9-DL1 cells (GFP⁺) were incubated in α-MEM (Gibco) supplemented with 20% FBS (CellMax). The AFT024 cell lines (ATCC) each with the gene encoding mIL3, mIL6, mSCF, and hFlt3L respectively been knocked in, were cultured in DMEM/high glucose supplemented with 10% FBS (Natocor), 0.1 mM β-mercaptoethanol, and 1% Sodium Pyruvate.

Mouse embryonic fibroblasts (MEFs) were derived from 13.5 d.p.c. C57BL/6 mouse embryos. MEFs were maintained in DMEM/high glucose (HyClone) and 10% FBS (Natocor) supplemented with 1% nonessential amino acids (NEAAs, Gibco). C57BL/6 mouse embryonic stem cells (Biocytogen), including GFP-ESCs, iRunx1-Hoxa9-Lhx2-ESCs, and iRunx1-Lhx2-ESCs, were maintained on feeder layers in ES medium containing DMEM/high glucose, 15% FBS (Gibco), 1% NEAA (Gibco), 1% GlutaMAX (Gibco), 1% sodium pyruvate (Gibco), 0.1 mM β-mercaptoethanol (Sigma), 1 μM PD0325901 (Selleck), 3 μM CHIR-99021 (Selleck), and 1000 U/mL LIF (PeproTech). OP9-DL1 cells (GFP⁺) were maintained in α-MEM (Gibco) supplemented with 20% FBS (Ausbian). The AFT024 cell line (ATCC) was maintained in DMEM/high glucose and 10% FBS (Natocor) supplemented with 0.1 mM β-mercaptoethanol and 1% sodium pyruvate.

Human PBMCs were isolated by Ficoll–Hypaque density gradient centrifugation, followed by negative selection with the B cell isolation kit (Invitrogen). The purity of CD19⁺ B cells was >90%. B cells were cultured in RPMI-1640 containing 10% fetal bovine serum (FBS, Natocor), 2.5 μg/ml F(ab′)₂ fragment goat anti-human IgA + IgG + IgM (Jackson ImmunoResearch), 100 ng/ml CD40 L (Gibco), 10 ng/ml IL-4 (Gibco), 10 ng/ml IL-10 (Gibco), 2.5 μg/ml CpG oligodeoxynucleotide 2006 (TCGTCGTTTTGTCGTTTTGTCGTT; Sangon Biotech), and 50 U/ml IL-2 (Gibco) for 2 days. Metformin (12.5 mM, Sigma), or oligomycin A (100 nM, MCE) was added to the culture medium, respectively. Rapamycin (5 μΜ, LC Labs) was added to the culture medium on the first day (24 hr) or 48 hr, respectively. The supernatants and cells were collected for analysis.
GCs were retrieved from follicular fluid of 7 healthy female subjects undergoing In Vitro Fertilization (IVF). GCs were cultured in RPMI-1640 (Gibco) supplemented with 10% FBS (Natocor), and with or without 10 ng/ml TNF-α (R&D) for 2 days. Cultured cells were lysed in TriPure isolation reagent (Roche), with storage at –80°C until RNA extraction.

The following cell types, HEK293T (CRL-3216), Vero (CCL-81), Hs 729T (HTB-153), THP-1 (TIB-202) and T84 (CCL-248), were obtained from the ATCC (Manassas, VA, USA). HEK293 cells were purchased from Microbix Biosystems Inc (Mississauga, ON, Canada), and 911 cells were already described [23 (link)]. HEK293T-hACE2 cells were already described [24 (link)]. All the cell lines were grown in the recommended medium supplemented with 15% of fetal bovine serum (Natocor, Cordoba, Argentina), 2 mM glutamine, 100 U/mL penicillin and 100 μg/mL streptomycin and maintained in a 37 °C atmosphere containing 5% CO₂. For the HEK293T and HEK293T-hACE2 cell cultures, non-essential amino acids (1X final concentration) were added. Immature dendritic cells (iDC) were generated from THP-1 monocytes as previously described [25 (link)]. To induce differentiation, THP-1 monocytes were cultured during 5 days in a RPMI-1640 medium (Gibco, Whaltman, MD, USA), 2-mercaptoethanol (0.05 mM final concentration; Gibco, Whaltman, MD, USA) and fetal bovine serum (10%), adding rhIL-4 (100 ng = 1500 IU/mL; Peprotech, Cranbury, NJ, USA) and rhGM-CSF (100 ng = 1500 IU/mL; Peprotech, Cranbury, NJ, USA). The acquired properties of iDCs were analyzed under a microscope. A medium exchange was performed every 2 days with a fresh cytokine-supplemented medium.

HEK-293T cells were grown in high glucose Dulbecco’s modified Eagle’s medium (DMEM, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (Natocor, Córdoba, Argentina), penicillin/streptomycin (Thermo Fisher Scientific, Waltham, MA, USA) and 110 mg/L of sodium pyruvate (Thermo Fisher Scientific, Waltham, MA, USA). Coronavirus Isolate hCoV-19/USA-WA1/2020 (BEI, NR-52281) and Argentinian isolate hCoV-19/Argentina/PAIS-C0102/2020 (D614G), adapted to grow in Vero cell line, were used for Virus Neutralization Assay (VNA). Isolate hCoV-19/USA-WA1/2020 was also used for mice challenge.