Total cell RNA was extracted using RNeasy Mini Kit according to the manufacturer’s protocol. Genomic DNA was removed using RNase-Free DNase set during the purification of RNA. ~500 ng of total RNA from each sample was subjected to reverse transcription (RT) reaction using RevertAid First Strand cDNA synthesis Kit (Thermo Scientific) according to the manufacture’s protocol. 2 μL of the final RT products were used for PCR amplification of target DsRed gene and GAPDH was run as a control for general RNA levels using EpiTaq HS polymerase (TaKaRa). 2 μL of cDNA was added in a total volume of 50 μL containing 2.5 × 10−3 ᴍ MgCl2, 1X PCR buffer, 0.3 × 10−3 ᴍ dNTP mixture, 0.5 × 10−6 ᴍ of each primer and 1.25 U of TaKaRa EpiTaq HS polymerase. Primers used for DsRed amplification were: FWD (5’-GCCTCCTCCGAGAACGTCATC-3’) and RVS (5’-CAGGAACAGTGTGTGGCGGC-3’). Primers for the housekeeping gene, GAPDH were FWD (5’-GTGGACCTGACCTGCCGTCT-3’) and RVS (5’-GGAGGAGTGGGTGTCGCTGT-3’). The PCR settings for both genes were as follows: 94 ˚C for 2 minutes, 30 cycles through 94 ˚C, 56 ˚C for 30 sec, 72 ˚C for 1 minute, then a final extension at 72 ˚C for 5 minutes. 1/10th of the PCR product was loaded onto a 1% agarose gel and run at 100 V for 45 minutes followed by a 15 minute Sybr Gold (NEB) staining and scanned on a Typhoon Trio gel scanner (GE).
Epitaq hs polymerase
Manufactured by Takara Bio
Sourced in China
EpiTaq HS polymerase is a high-fidelity DNA polymerase designed for accurate amplification of DNA templates. It exhibits enhanced thermal stability and possesses 3' to 5' exonuclease activity, providing efficient and precise DNA replication.
Automatically generated - may contain errors
Lab products found in correlation
Ez dna methylation kit, by Zymo Research (2 mentions)
Pgem t easy vector, by Promega (2 mentions)
Sybr gold, by New England Biolabs (1 mentions)
Typhoon trio gel scanner, by GE Healthcare (1 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Epitect plus dna bisulfite kit, by Qiagen (1 mentions)
Agilent 2200 tapestation, by Agilent Technologies (1 mentions)
Ampure xp bead, by Beckman Coulter (1 mentions)
Bisulfite conversion kit, by Active Motif (1 mentions)
Pgem t easy vector system, by Promega (1 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
Qiaex 2 gel extraction kit, by Qiagen (1 mentions)
Abi 3730 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Pmd19 t vector, by Takara Bio (1 mentions)
Ez 96 dna methylation gold kit, by Zymo Research (1 mentions)
Ez dna methylation direct kit, by Zymo Research (1 mentions)
Methyl primer express v1, by Thermo Fisher Scientific (1 mentions)
Anti hif 1α, by BD (1 mentions)
Anti sumo1, by Santa Cruz Biotechnology (1 mentions)
Cd4 apc, by BioLegend (1 mentions)
10 protocols using epitaq hs polymerase
1
Quantitative RT-PCR Analysis of DsRed Expression
2
Bisulfite Sequencing of HBV CpG Islands
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from frozen liver samples was isolated using the Proteinase K/phenol method [28 (link)]. Isolated genomic DNAs were modified with the EpiTect Plus DNA Bisulfite Kit, according to the manufacturer´s protocol (Qiagen). Amplification of two CpG island regions from HBV fragment was performed using EpiTaq HS polymerase (Clontech) and the following primer pairs: CpG island I,
5′- TTTTTATTAAATTTTGTAAGATTTTAGAGTGAGAGG -3′ and 5′- TAAAAACTACRAATTTTAACCAAAACACAC -3′; CpG island II, 5′- AATATATATYGTTTTTATGGTTGTTAGGTTGTG -3′ and 5′- AAAATCCAAAAATCCTCT TATATAAAACCTTAAAC -3′.
The actual methylation status of amplified fragments was determined through direct PCR product sequencing.
5′- TTTTTATTAAATTTTGTAAGATTTTAGAGTGAGAGG -3′ and 5′- TAAAAACTACRAATTTTAACCAAAACACAC -3′; CpG island II, 5′- AATATATATYGTTTTTATGGTTGTTAGGTTGTG -3′ and 5′- AAAATCCAAAAATCCTCT TATATAAAACCTTAAAC -3′.
The actual methylation status of amplified fragments was determined through direct PCR product sequencing.
3
Targeted FKBP5 Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We optimized the amplifications of 28 regions covering 302 CpGs within GR and/or CTCF binding sites as well as the transcription start site of the FKBP5 locus (see Additional file 9 : Table S4 for primers and mapping of the amplicons). In order to reduce cost and maximize the number of samples per sequencing run, triplicate bisulfite treatments were performed for each sample and then pooled to run one PCR amplification per amplicon [25 (link)]. Overall, 200 ng to 500 ng of DNA was used per sample and bisulfite treated using the EZ DNA Methylation Kit (Zymo Research, Irvine, CA). Twenty nanograms of bisulfite-converted DNA was then used for each PCR amplification employing Takara EpiTaq HS Polymerase (Clontech, Saint-Germain-en-Laye, France) and 49 amplification cycles. PCR amplicons were then quantified with the Agilent 2200 TapeStation (Agilent Technologies, Waldbronn, Germany) and pooled in equimolar quantities for each sample. AMPure XP beads (Beckman Coulter, Krefeld, Germany) were used for a double size selection (200–500 bp) to remove primer dimers and high molecular DNA fragments.
4
Bisulfite Sequencing of HIV-1 LTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite sequencing was performed according to the previous report56 (link) with some modifications. Total genomic DNA was extracted using the DNeasy Blood and Tissue Kit (QIAGEN) according to the manufacturer’s recommendations. Methylation analysis has been performed using Bisulfite conversion kit (Active Motif, Cat#55016). Bisulfite-treated DNA was amplified using PCR in a 50-µl reaction mixture using EpiTaq HS polymerase (TAKARA, R110A). The master mix contained 50 mM Tris-HCl (pH 9.2), 1.75 mM MgCl2, each dNTP at 350 µM, and each primer at 45 pmol. Primers for the HIV 5′ LTR were used according to the previous report56 (link). PCR was performed with about 50 ng of genomic DNA for 40 cycles at 95 °C for 60 s, 58 °C for 120 s, and 72 °C for 60 s. Amplification products were cloned in the pGEM-T-Easy Vector System (Promega, Madison, WI). Cloned DNA from positive clones was checked for specific bands and at least 10 positive bands from each Timer clone were sent for Sanger sequencing. Retrieved sequences were then trimmed to remove the bad quality scored reads at an Error Probability Limit of 0.05, aligned to the 5’LTR (HXB2) reference genome. Converted and un-converted Cytosine residues were counted and a percentage for total mCpGs was calculated relative to the total number of CpG islands checked using Geneiuos Prime 2023.2.1. (Supplementary Fig. 12 ).
5
Methylation Analysis of Foxp3+ Cells
6
Analyzing Enhancer Methylation Patterns
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was purified with phenol-chloroform and subjected to bisulfite conversion according to the EZ DNA Methylation-Direct™ Kit (Zymo Research). Then, primer pairs specific for each investigated enhancer were used for PCR amplification with the EpiTaq HS polymerase (TaKaRa). Finally, the resulting amplicons were gel-purified, subjected to blunt-end cloning, and analyzed by Sanger sequencing. The target sequence and the bisulfite primer for the selected PGCLC enhancers are listed in Supplementary Data 6 .
7
Bisulfite Sequencing of OsGUN4 Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite sequencing was used to identify methylated cytosines in OsGUN4. About 1 μg genomic DNA each was extracted from six 35-day-old rice seedlings. The DNA was treated with sodium bisulfite using the EZ DNA Methylation Kit (Zymo Research, Irvine, CA, USA) and the primers for amplification of OsGUN4 (F: GGTTGGGAGTGTGTTTTAA, R: CAAAATAATACRCATAACAACAC) were designed by the Methyl Primer Express v1.0 (Applied BioSystems, USA) (Li et al., 2014 (link)). PCRs of the bisulfite-treated genomic DNAs were produced with EpiTaq HS polymerase (Takara, Dalian, China), and the PCR products were purified and cloned into the pGEM-T easy vector (Promega, Madison, WI, USA). At least 20 clones of each plant were sequenced and used for analysis of methylated cytosines with the Kismeth software (Gruntman et al., 2008 (link)).
8
Antibody-based Transcription Factor Analysis
9
Bisulfite Sequencing of Genomic DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was subjected to bisulfite conversion using an EZ DNA Methylation-Gold kit (Zymo Research). The bisulfite converted DNA was PCR amplified by EpiTaq HS polymerase (Takara) using the primer sets listed in Supplementary Table S1 . The PCR products were subcloned into a pGEM-T Easy vector (Promega) and sequenced using a SP6 primer.
10
Genome-Wide DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
gDNA isolated from both F2 thoracic aortas and F1 sperm was carried out by using QIAamp DNA Mini Kit (QIAGEN, 51304, Hilden, Germany). Bisulfate treatment of gDNA was performed by using EZ DNA Methylation-Gold KitTM (ZYMO Research, D5005, Irvine, CA, USA), according to the manufacturer’s instructions. PCR primers were designed with MethPrimer (http://www.urogene.org/methprimer/ ), and bisulfite-treated DNA was amplified with EpiTaq HS polymerase (Takara, R110Q, Beijing, China).
The PCR products were separated by using agarose gel electrophoresis and purified by using the Wizard® SV Gel and PCR Clean-Up System (Promega, A9281, Madison, WI, USA). Purified DNA fragments were cloned into pMD T-19 (Takara, No. 6013Code) and ten clones from each PCR assay were subjected to next direct sequencing. The final sequence results were analyzed by online QUMA (quantification tool for methylation analysis) software [22 (link)]. Primer sets used in bisulfate modified PCR are shown in Supplementary TableS1 .
The PCR products were separated by using agarose gel electrophoresis and purified by using the Wizard® SV Gel and PCR Clean-Up System (Promega, A9281, Madison, WI, USA). Purified DNA fragments were cloned into pMD T-19 (Takara, No. 6013Code) and ten clones from each PCR assay were subjected to next direct sequencing. The final sequence results were analyzed by online QUMA (quantification tool for methylation analysis) software [22 (link)]. Primer sets used in bisulfate modified PCR are shown in Supplementary Table
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!