Hsa mir 21 5p

RT-qPCR was carried out as described above. Commercial LNA-enhanced primer assays for hsa-miR-223-3p, hsa-miR-199a-3p, hsa-miR-191-5p, hsa-miR-151a-5p, hsa-miR-148b-3p, hsa-miR-126-3p, and hsa-miR-21-5p (all Qiagen) were used. For each miRNA, 5′phosphorylated RNA oligos were synthesized (Table 2). The RNA mimics (IDT) were diluted corresponding to 10⁹ to 10³ copies/qPCR well and included in the RT reaction. The obtained Cq values within the linear range were used to fit a line to the data from each dilution series. Using the standards curves, raw Cq values from the samples were converted to copies/platelet or copies/μL plasma.

3D-models and organoids were separated from matrigel by washing with PBS. Cell lines and mPDAC tumors were lysed using Trizol and RNA extraction was conducted using the mirVana miRNA Isolation Kit. cDNA synthesis was performed using miScript II RT Kit (Qiagen) with 250 ng input RNA. qRT-PCR was performed using the Roche480 Light Cycler^® miRNA system as per manufacturer’s instructions, and gene expression was normalized to U6 and/or 18s. For KRAS mRNA analysis, cDNA synthesis was performed using Verso cDNA Synthesis Kit (Life technology) using 500–1000 ng input RNA. cDNA was used for SYBR Green-based real-time PCR. Gene expression was normalized to GAPDH. Hsa-miR-21-5p, mmu-miR-21-5p, Hsa-miR-217-5p, mmu-miR-217-5p, U6 and 18s miScript Primers were obtained from Qiagen.
The KRAS primers used for mouse and human are F:AGAGGACTCCTACAGGAAACAAGTAGTAATTGAT
R:AGCCCTCCCCAGTTCTCATGT

RNA was extracted from the A549, LL2 and L132 cells with the miRCURY LNA miRNA PCR Starter Kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s instructions. Then, the quantitative real time-polymerase chain reaction (qPCR) was performed using miRCURY SYBR Green PCR Master Mix (contained in the aforementioned kit) according to the manufacturer’s instructions. The thermocycling parameters were as follows: 95 °C for 2 min, followed by 40 cycles of 95 °C for 10 s, and 60 °C for 60 s. qPCR assays were performed on an ABI 7900 system (ABI), and the 2^−ΔΔCt method was applied for the calculation of relative levels of expression. hsa-miR-21-5p (YP00204230, Qiagen, Germantown, MD, USA)) was used to detect miR-21 expression levels, and has-miR-103-3p (YP00204063, Qiagen, Germantown, MD, USA) and has-miR-191-5p (YP00204306, Qiagen, Germantown, MD, USA) were used as the internal references.