Hsa mir 21 5p
Hsa-miR-21-5p is a microRNA (miRNA) sequence that is part of the miR-21 gene located on chromosome 17q23.2. miRNAs are small, non-coding RNA molecules that play a role in gene expression regulation.
Lab products found in correlation
5 protocols using hsa mir 21 5p
RT-qPCR Quantification of miRNA Expression
Quantitative Analysis of miRNA and KRAS mRNA
The KRAS primers used for mouse and human are F:AGAGGACTCCTACAGGAAACAAGTAGTAATTGAT
R:AGCCCTCCCCAGTTCTCATGT
Quantifying miRNA Expression Levels
Hippocampal RNA Extraction and qRT-PCR Analysis
Quantifying miRNA-21 Expression Levels
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!