Rnasimple total kit

The osteogenic-related genes, including alkaline phosphatase (Alp), runt-related transcription factor 2 (Runx2), and osteocalcin (Ocn), were further investigated by RT-qPCR. The BMSCs were cultured with different membranes for 4, 7, and 14 days, followed by the isolation of total RNA using the RNA simple Total Kit (TianGen, China). The RT-qPCR evaluated the expression level of Alp, Runx2, and Ocn by SYBR Premix Ex Taq and the light cycler 96 system (Roche, Germany). GAPDH served as the housekeeping gene. Fold changes in gene expression were calculated by the 2^−ΔΔCT method. The primer sequence of each gene was noted as follows (Table 1).

Total RNA was extracted from cells using the RNA simple Total Kit (TIANGEN). cDNA was synthesized using FastQuant RT kit(TIANGEN). Furthermore, Quantitative real-time PCR experiments were using SuperReal PreMix Plus SYBR Green kit (TIANGEN).³¹GP130 mRNA levels were measured using the primer (forward: 5′-CGGACAGCTTGAACAGAATGT-3′ and reverse: 5′-ACCATCCCACTCACACCTCA-3′), GAPDH (forward: 5′-TGCACCACCAACTGCTTAGC-3′ and reverse: 5′-GGCATGGACTGTGGTCATGAG-3′).

With the RNAsimple Total Kit (Tiangen), total RNA from cancer cells was collected in RZ buffer. The RNA quality and quantity were measured with NanoDrop ND-1000. Besides, the RNA integrity was assessed by standard denaturing agarose electrophoresis. The synthesis of 500 ng of total RNA via reverse transcription using High Capacity cDNA Reverse Transcription Kit (Thermo Fisher) produced cDNA. The RT-qPCR assay was performed by using ChamQ^TM Universal SYBR qPCR Master Mix (Vazyme). Gene-specific primer sequences are listed in Table 2.

RNA extraction was performed according to the RNA Simple Total Kit protocol (Tiangen Biotech, Beijing, China). A NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) was used to quantify the RNA samples. RT Master Mix (Takara Bio, Inc., Dalian, China) was used for cDNA synthesis. The samples were run on a real-time PCR detection system (Eppendorf, Hamburg, Germany) with a SYBR green-based PCR method for mRNA expression analysis. All reactions were prepared in triplicate. Target gene expression was analysed using the comparative cycle threshold (CT) method [22 (link)].

Total RNA was isolated from the mouse retinas with a Trizol reagent according to the RNAsimple Total Kit instructions (Tiangen Biotech, Beijing, China), which was then reverse transcribed into complementary DNA (cDNA) with a reagent kit (Takara Bio Inc., Dalian, China). The RT‐PCRs, using a SYBR green‐based PCR method, were performed with a real‐time PCR detection system (Eppendorf, Hamburg, Germany). GAPDH was used as an internal reference to normalize the variation amounting to total cDNA. The forward and reverse primers for mouse GAPDH were 5′‐AGGTCGGTGTGAACGGATTTG‐3′ and 5′‐TGTAGACCATGTAGTTGAGGTCA‐3′. The forward and reverse primers for mouse iNOS were 5′‐GTTCTCAGCCCAACAATACAAGA‐3′ and 5′‐GTGGACGGGTCGATGTCAC‐3′. The forward and reverse primers for mouse TGF‐β were 5′‐CTCCCGTGGCTTCTAGTGC‐3′ and 5′‐GCCTTAGTTTGGACAGGATCTG‐3′. The forward and reverse primers for mouse Arg‐1 were 5′‐CTCCAAGCCAAAGTCCTTAGAG‐3′ and 5′‐AGGAGCTGTCATTAGGGACATC‐3′. The forward and reverse primers for mouse Egr1 were 5′‐TCGGCTCCTTTCCTCACTCA‐3′ and 5′‐CTCATAGGGTTGTTCGCTCGG‐3′; the forward and reverse primers for mouse Fos were 5′‐CGGGTTTCAACGCCGACTA‐3′ and 5′‐TTGGCACTAGAGACGGACAGA‐3′. Experiments were performed in three parallel wells and repeated at least twice.

Total RNA was isolated by the RNA Simple Total kit (TianGen, Beijing, China), and P. gingivalis OMV sRNAs were isolated by the RNAeasy small RNA isolation kit (Beyotime Biotechnology, Shanghai, China). In addition, cDNA was generated with a PrimeScript RT master mix for quantitative PCR (qPCR) (TaKaRa, Kyoto, Japan), followed by analysis using an SYBR Premix Ex Taq II (TaKaRa, Kyoto, Japan). Stem-loop reverse transcription was utilized to reverse msRNAs because of the short fragment. PCR conditions consisted of an initial 30 s of denaturation at 95°C, followed by 40 cycles of 95°C for 5 s, and 60°C for 30 s. All reactions were performed in triplicate. Change in transcript abundance of all tested genes was calculated using the threshold cycle (2^−ΔΔCT) method. The primers used in the study are listed in Table 1 and Table 2.

Total RNA was extracted from mouse RPE-choroid complexes or primary mouse RPE cells using the RNA Simple Total Kit following the manufacturer's protocol (Tiangen Biotech). RNA sample quality and concentration were detected using a NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific). RT Master Mix (TaKaRa Bio, Inc.) was used to reverse-transcribe RNA to cDNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used to normalize the data. The primer sequences are shown in Supplementary Table S2. The RealPlex4 real-time PCR detection system (Eppendorf Co., Ltd.) was used to amplify cDNA with a program consisting of 40 cycles of amplification (Tm = 60 °C). The 2^-ΔΔCt method was used to calculate the gene expression level of each mRNA.