Shuffle t7 competent e coli

bEnd.3 cells (ATCC CRL-2299) were from ATCC (Manassas, VA). SHuffle T7 Competent E. coli was from New England BioLabs Inc. (Ipswich, MA). DNA oligos encoding ICAM-1 Binding Peptide with BseRI sticky ends (/5Phos/GATTACCGACGGCGAAGCGACCGATAGCGGCGG, /5Phos/GCCGCTATCGGTCGCTTCGCCGTCGGTAATCCC) was synthesized by Integrated DNA Technologies (Coralville, IA). The plasmid expressing mICAM-1 turboGFP was from Origene (Rockville, MD). Rapamycin was from LC Laboratories (Woburn, MA, U.S.A.). NHS-Fluorescein, NHS-Rhodamine, and Zeba™ Spin Desalting Columns, 7K MWCO (10 mL), and LysoTracker™ Green DND-26 were from ThermoFisher Scientific Inc. (Rockford, IL). Sulfo-Cyanine 7.5 NHS ester was from Lumiprobe Corp (Hallandale Beach, FL). Goat antimouse ICAM-1 polyclonal antibody was from R&D Systems (Minneapolis, MN). Other reagents were from standard suppliers.

The fusion protein was expressed in Shuffle® T7 competent
E. coli (New England Biolabs, MA, USA) at 30 °C
until optical density (OD) at 600 nm reached 0.6. Once the OD at 600 nm reached
0.6, the bacteria were induced with with the final concentration of 0.4 mM
isopropyl β-D-1- thiogalactopyranoside (IPTG) at room temperature
overnight. The expressed hGMCSF-A192 was purified by using three hot and cold
cycles (Figure 1C). To measure hGMCSF-A192
protein concentration, the protein was denatured with 6 M guanidine
hydrochloride to disrupt the assembly of nanoparticles, and the concentration,
C_ELP, was obtained using the
following equation: $$C_{ELP}=\frac{A_{280}-A_{350}}{\epsilon l}$$ where A₂₈₀ is the
absorbance at 280 nm, A₃₅₀ is the
absorbance at 350 nm, ε is the molecular extinction
coefficient at 280 nm, and I is the path length (cm). The molar
extinction coefficient, ε, was calculated using the
following equation: $$\mathrm{\epsilon }=125n_{Cystine}+5500n_{Tryptophan}+1490n_{Tyrosine}$$ The ε of hGMCSF-A192 was estimated to be 15,720
M⁻¹ cm⁻¹ as ε of
hGMCSF and A192 were calculated to be 14,230 M⁻¹cm⁻¹ assuming both pairs of cysteine residues form cystine
disulfide bonds and 1,490 M⁻¹ cm⁻¹,
respectively.^{35 (link)} The
A₂₈₀ and A₃₅₀ for the samples were determined using a
NanoDrop 2000 (Thermo Fisher, MA, USA), which has a path length of 0.1 cm.