Iscript reverse transcriptase cdna synthesis kit

Manufactured by Bio-Rad

Sourced in Australia

The IScript reverse-transcriptase cDNA synthesis kit is a laboratory tool used for the synthesis of complementary DNA (cDNA) from RNA templates. The kit contains the necessary components, including the IScript reverse transcriptase enzyme, to perform this conversion process.

Automatically generated - may contain errors

Lab products found in correlation

Dnase step, by Qiagen (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Itaq universal sybr green supermix, by Bio-Rad (1 mentions) Rotor gene q, by Qiagen (1 mentions) Rnaeasy micro kit, by Qiagen (1 mentions) Agilent bioanalyzer, by Agilent Technologies (1 mentions)

Spelling variants of this product

IScript kit (577 citations) CDNA synthesis kit (284 citations) IScript reverse transcriptase (256 citations) IScript cDNA kit (182 citations) IScript cDNA synthesis (101 citations) IScript synthesis kit (80 citations) IScript reverse transcriptase kit (78 citations) Reverse transcriptase (30 citations) Reverse Transcriptase Kit (5 citations) IScript cDNA reverse transcriptase (3 citations)

4 protocols using iscript reverse transcriptase cdna synthesis kit

cDNA Synthesis and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The iScript reverse-transcriptase cDNA synthesis kit (Bio-Rad, Sydney, NSW, Australia) was used to synthesize cDNA following the manufacturer’s recommendations. Quantitative reverse transcription PCR was performed using iTaq^TM Universal SYBR^® green supermix (Bio-Rad, Sydney, NSW, Australia) in conjunction with a Rotor-Gene Q (Qiagen, Melbourne, VIC, Australia) with oligonucleotides designed in PRIMER Biosoft NetPrimer (www.premiersoft.com, accessed on 10 July 2016) (Table S1). A typical quantitative reverse transcription PCR run was 2 min at 95 °C followed by 40 cycles of 10 s at 95 °C, 15 s at 60 °C, and 20 s at 72 °C [45 (link)]. Transcriptional differences were calculated using the 2^−ΔΔCT method [46 (link)] and the 16S rRNA (A1S_r01) and GAPDH (A1S_2501) transcription levels were used as a reference.

Giles S.K., Stroeher U.H., Papudeshi B., Edwards R.A., Carlson-Jones J.A., Roach M, & Brown M.H. (2022). The StkSR Two-Component System Influences Colistin Resistance in Acinetobacter baumannii. Microorganisms, 10(5), 985.

+ Open protocol

+ Expand

RT-qPCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using RNAeasy Micro Kit (Qiagen catalog No. 74004) or Trizol extraction. cDNA synthesis was performed using BioRad iScript Reverse Transcriptase cDNA synthesis kit (1708840). RT‐qPCR was performed using IQ BioRad SYBR Green Supermix (170‐8880). Expression of the gene of interest was normalized to GAPDH expression for hydrogel experiments and TBP (TATA‐binding protein) for isoproterenol experiments. Primer sequences are listed in Table 2.

Ceccato T.L., Starbuck R.B., Hall J.K., Walker C.J., Brown T.E., Killgore J.P., Anseth K.S, & Leinwand L.A. (2020). Defining the Cardiac Fibroblast Secretome in a Fibrotic Microenvironment. Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease, 9(19), e017025.

+ Open protocol

+ Expand

Quantification of mRNA Expression in Cocaine-Exposed Rodents and Humans

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse and rat NAc tissue punches were collected 24 h after the last cocaine administration and stored at −80°C. RNA was extracted using Trizol (Invitrogen) and the MicroElute Total RNA Kit (Omega) with a DNase step (Qiagen). For human postmortem NAc tissue, total RNA was isolated by using Trizol (Invitrogen) as described before (Golden et al., 2013 (link)). Human RNA integrity was determined on an Agilent Bioanalyzer. All RNA quantity was measured on a Nanodrop. 300–400ng cDNA was then synthesized using reverse transcriptase iScript cDNA synthesis kit (Bio-Rad). mRNA expression changes were measured using quantitative polymerase chain reaction (qPCR) with PerfeCTa SYBR Green FastMix (Quanta). Quantification of mRNA changes was performed using the −Δ∆ C_T method, using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a housekeeping gene. The list of primers used in this study is included in Table S2. Complete list of regents can be found in the Key resource table.

Chandra R., Engeln M., Schiefer C., Patton M.H., Martin J.A., Werner C.T., Riggs L.M., Francis T.C., McGlincy M., Evans B., Nam H., Das S., Girven K., Konkalmatt P., Gancarz A.M., Golden S.A., Iñiguez S.D., Russo S.J., Turecki G., Mathur B.N., Creed M., Dietz D.M, & Lobo M.K. (2017). Drp1 mitochondrial fission in D1 neurons mediates behavioral and cellular plasticity during early cocaine abstinence. Neuron, 96(6), 1327-1341.e6.

+ Open protocol

+ Expand

Quantifying PGC-1α Expression in Cocaine-Treated Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

AAV-DIO-PGC-1α-mCitrine or AAV-DIO-EYFP infused in D1-Cre or D2-Cre mice or C57BL/6J mice NAc tissue punches were collected 24 h after the last cocaine administration and stored at −80°C. RNA was extracted using Trizol (Invitrogen) and the MicroElute Total RNA Kit (Omega) with a DNase step (Qiagen). All RNA quantity was measured on a Nanodrop. 300–400ng cDNA was then synthesized using reverse transcriptase iScript cDNA synthesis kit (Bio-Rad). mRNA expression changes were measured using quantitative polymerase chain reaction (qPCR) with PerfeCTa SYBR Green FastMix (Quanta). Quantification of mRNA changes was performed using the −ΔΔ CT method, using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a housekeeping gene. The list of primers used in this study is included GAPDH forward: AGGTCGGTGTGAACGGATTTG, GAPDH reverse: TGTAGACCATGTAGTTGAGGTCA, PGC-1α forward: CGACCATGGTGTTGTTCTTG, and PGC-1α reverse ATGGCAGCGACTCCATACTC.

Chandra R., Engeln M., Francis T.C., Konkalmatt P., Patel D, & Lobo M.K. (2016). A role for PGC1-alpha in nucleus accumbens neuron subtypes in cocaine action. Biological psychiatry, 81(7), 564-572.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!