Mir 19a

Total RNA from cartilage tissues and LPS‐treated primary chondrocytes was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). A reverse transcription kit (Abcam) and the SYBR Green Master Mix Kit (Qiagen, Hilden, Germany) were used to amplify special gene expression on the Applied Biosystems 7500 Real‐Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). The expression level of DANCR and miR‐19a were calculated using comparative threshold cycle value (2^−ΔΔCt) method, compared with glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) and U6 small nuclear RNA (U6), respectively. Polymerase chain reaction (PCR) primers were as follows: DANCR:¹⁷ 5′‐GCGCCACTATGTAGCGGGTT‐3′ (sense) and 5′‐TCAATGGCTTGTGCCTGTAGTT‐3′ (antisense); U6: 5′‐CTCGCTTCGGCAGCACA‐3′ (sense) and 5′‐AACGCTTCACGAATTTGCGT‐3′ (antisense); GAPDH: 5′‐AAGAAGGTGGTGAAGCAGGC‐3′ (sense) and 5′‐TCCACCACCCTGTTGCTGTA‐3′ (antisense). The primers for miRNA‐19a‐3p (miR‐19a) were purchased from Qiagen. All experiments were performed in at least three wells, and relative gene expression was normalized to control groups (as unit 1).