Log In Sign up
The largest database of trusted experimental protocols

Rb pab

Manufactured by Abcam
Visit Supplier

Rb pAb is a rabbit polyclonal antibody. It is designed for use as a research tool.

Automatically generated - may contain errors

Lab products found in correlation

Hs cdc42 7 flexitube sirna, by Qiagen (2 mentions) Qscript cdna supermix, by Quanta Biosciences (2 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions) Quantitect sybr green pcr kit, by Qiagen (2 mentions) Alexa fluor 488, by Thermo Fisher Scientific (2 mentions) Fsx100 inverted microscope, by Olympus (1 mentions) Axiocam mr3, by Zeiss (1 mentions) Prolong gold antifade mountant, by Thermo Fisher Scientific (1 mentions) Poly d lysine laminin, by BD (1 mentions)

3 protocols using rb pab

1

Immunocytochemistry and CLSM Analysis

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunocytochemistry and CLSM were performed as previously described [74 (link),75 (link)]. Cells were cultured on 12 mm round coverslips coated with poly-D-Lysine/Laminin (BD Bioscience, Franklin Lakes, NJ). Cells were fixed with 4% paraformaldehyde for 20 min, then permeabilized with 0.1% Triton X-100 in PBS for 10 min. Cells were incubated in a blocking buffer containing 1% bovine serum albumin (for MZF1 and SCAND2) or, alternatively, 3% normal goat serum (for SCAND1) in PBS for 30 min, incubated with primary antibodies at 4 °C overnight and then with secondary antibodies at RT for 1 h in the blocking buffer. Cells were washed thrice with PBS for 5 min between the steps. Cells were mounted within ProLong Gold Antifade Mountant (Thermo Fisher Scientific). Fluorescence images were acquired using Axio Vision CLSM (Zeiss, Oberkochen, Germany) with an AxioCam MR3 (Zeiss) camera for SCAND1, and alternatively, FSX100 inverted microscope (Olympus, Tokyo, Japan) for MZF1 and SCAND2. We used antibodies against MZF1 (C10502, Rb pAb, Assay Biotechnology, Fremont, CA), SCAND1 (ab64828, Rb pAb, Abcam), SCAND2 (5F1, H00054581-M02, Ms mAb, Thermo Fisher Scientific), and anti-rabbit IgG conjugated with Alexa Fluor 488 (Thermo Fisher Scientific).
Sheta M., Yoshida K., Kanemoto H., Calderwood S.K, & Eguchi T. (2023). Stress-Inducible SCAND Factors Suppress the Stress Response and Are Biomarkers for Enhanced Prognosis in Cancers. International Journal of Molecular Sciences, 24(6), 5168.
+ Open protocol
+ Expand
2

Silencing CDC42 in Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For silencing CDC42, sixty percent confluent HUVECs were transfected for 6 h with 20nM CDC42 siRNA (Hs_CDC42_7 FlexiTube siRNA, Qiagen) or Scrambled, in a solution of Lipofectamine™ RNAiMAX (invitrogen) according to manufacturer’s instructions. Expression levels of CDC42 were assessed by Real time PCR (qScript™ cDNA SuperMix, Quanta Bioscience for cDNA synthesis, and QuantiTect SYBR Green PCR Kit, Qiagen for PCR reaction) and by antibody staining (mouse anti-CDC42, Clone 44, BD Biosciences). GAPDH primers used: Fw (5′-3′) GTCTCCTCTGACTTCAACAGCG and Rv (3′-5′) ACCACCCTGTTGCTGTAGCCAA). Human CDC42 primers used: Fw (5′-3′) TGACAGATTACGACCGCTGAGTT and Rv (3′-5′) GGAGTCTTTGGACAGTGGTGAG). Channels within molds were seeded with transfected HUVECs and either left in culture for apoptosis and sprouting assay, or implanted in vivo in a model of hind limb ischaemia. Active caspase 3 (Rb pAb, Abcam ) staining was used to determine the percentage of apoptotic cells within channels. The growth of angiogenic sprouts from patterned vessels was tested after a four day culture in fibroblast conditioned media-EGM2 medium (1:1), followed by fixation in 4% PFA for 30 min and phalloidin (Invitrogen) staining for 1h.
Mirabella T., MacArthur J.W., Cheng D., Ozaki C.K., Woo Y.J., Yang M, & Chen C.S. (2017). 3D-printed vascular networks direct therapeutic angiogenesis in ischaemia. Nature biomedical engineering, 1, 0083.
+ Open protocol
+ Expand
3

Silencing CDC42 in Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For silencing CDC42, sixty percent confluent HUVECs were transfected for 6 h with 20nM CDC42 siRNA (Hs_CDC42_7 FlexiTube siRNA, Qiagen) or Scrambled, in a solution of Lipofectamine™ RNAiMAX (invitrogen) according to manufacturer’s instructions. Expression levels of CDC42 were assessed by Real time PCR (qScript™ cDNA SuperMix, Quanta Bioscience for cDNA synthesis, and QuantiTect SYBR Green PCR Kit, Qiagen for PCR reaction) and by antibody staining (mouse anti-CDC42, Clone 44, BD Biosciences). GAPDH primers used: Fw (5′-3′) GTCTCCTCTGACTTCAACAGCG and Rv (3′-5′) ACCACCCTGTTGCTGTAGCCAA). Human CDC42 primers used: Fw (5′-3′) TGACAGATTACGACCGCTGAGTT and Rv (3′-5′) GGAGTCTTTGGACAGTGGTGAG). Channels within molds were seeded with transfected HUVECs and either left in culture for apoptosis and sprouting assay, or implanted in vivo in a model of hind limb ischaemia. Active caspase 3 (Rb pAb, Abcam ) staining was used to determine the percentage of apoptotic cells within channels. The growth of angiogenic sprouts from patterned vessels was tested after a four day culture in fibroblast conditioned media-EGM2 medium (1:1), followed by fixation in 4% PFA for 30 min and phalloidin (Invitrogen) staining for 1h.
Mirabella T., MacArthur J.W., Cheng D., Ozaki C.K., Woo Y.J., Yang M, & Chen C.S. (2017). 3D-printed vascular networks direct therapeutic angiogenesis in ischaemia. Nature biomedical engineering, 1, 0083.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!