The small interfering RNAs (siRNAs) that specifically target to silence linc00511 (si-linc00511-1 and si-linc00511-2), miRNAs mimics, double-stranded RNAs (dsRNAs), biotin-labeled miRNAs, and the corresponding controls were structured by GenePharma (Suzhou, China). These RNAs were transfected into cells using Lipofectamine 3000 (Invitrogen, CA, USA). Then, the cells were harvested and applied to experiments after transfection for 24, 48, and 72 h. Similarly, the pcDNA3.1 vector (GenePharma, Suzhou, China) targeting linc00511 was performed for stable aberrant expression of linc00511, and the transfection procedure was also conducted using Lipofectamine 3000.
Double stranded rnas
Manufactured by GenePharma
Sourced in China
Double-stranded RNAs (dsRNAs) are synthetic molecules composed of two complementary strands of ribonucleic acid (RNA). The core function of dsRNAs is to serve as essential tools for RNA interference (RNAi) research and applications.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Pcdna3.1 vector, by GenePharma (1 mentions)
Lipofectamine 3000, by GenePharma (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Hbepic, by ScienCell (1 mentions)
Fetal calf serum (fcs), by Thermo Fisher Scientific (1 mentions)
Bronchial epithelial cell medium, by ScienCell (1 mentions)
3 protocols using double stranded rnas
1
Silencing linc00511 in Cell Lines
2
Lipofectamine-Mediated miRNA Overexpression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The transfection process was performed with Lipofectamine 2000 (Invitrogen, USA) following the manufacturer's instructions. The miRNA mimics were chemically synthesized by GenePharma (China), double-stranded RNAS that mimic mature endogenous miRNAS after transfection into cells. Overexpression and short hairpin RNA adenovirus were purchased from Genomeditech (China).
3
miR-194-3p Modulation in HBEpiCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HBEpiCs (ScienCell Research Laboratories, Inc., San Diego, CA, USA) were cultured in bronchial epithelial cell medium (ScienCell Research Laboratories, Inc.) at 37°C in a 5% CO2 atmosphere. In total, 30 nM miR-194-3p mimics, inhibitors or scrambled controls were non-transfected or pre-transfected into HBEpiCs with DMEM with 3% fetal calf serum (Thermo Fisher Scientific, Waltham, MA, USA) for 48 h. Transfection of each reagent was performed using Lipofectamine® 3000 (Thermo Fisher Scientific). The mimics and negative control of miR-194-3p were chemically synthesized as double-stranded RNAs (GenePharma Co., Ltd., Shanghai, China) using the following sequence (5′→3′): mimics sense CCAGUGGGGCUGCUGUUAUCUG and anti-sense GAUAACAGCAGCCCCACUGGUU; negative control sense UUCUCCGAACGUGUCACGUTT and anti-sense ACGUGACACGUUCGGAGAATT. The inhibitors and inhibitor-negative control were synthesized as single-stranded RNAs using the following sequence: inhibitor CAGAUAACAGCAGCCCCACUGG and inhibitor-negative control CAGUACUUUUGUGUAGUACAA. Before analysis, HBEpiCs were treated with normal media, CSS or PM2.5-CSS for 24 h.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!