Plenti cmv slc7a11 sh926r flag ires hygro

1C‐TAZ‐WT, 1C‐TAZ‐4SA, 1C‐TAZ‐4SA‐mNLS were kind gifts from Andras Kapus. pBabe‐puro‐HA‐EV, and pBabe‐puro‐HA‐YAP‐5SA were kind gifts from Alex Hergovich. pLenti‐CMV‐SLC7A11‐sh926R‐FLAG‐IRES‐Hygro was purchased from Addgene (# 118702). To generate pSuper‐retro‐puro‐shYAP/TAZ construct, the oligonucleotide 5′‐TGTGGATGAGATGGATACA‐3′ which targets both YAP and TAZ mRNAs was cloned into pSuper‐retro‐puro vector. To generate pGL4.10‐SLC7A11, a DNA fragment from −1,000 bp to +200 bp containing the SLC7A11 promoter was cloned into the pGL4.10 vector.
On‐target siRNAs were purchased from Horizon Discovery and are listed in Appendix Table S1. Antibodies used are listed in Appendix Table S2, and PCR primers are listed in Appendix Table S3.

pCMV5 HA Capicua was purchased from MRC-PPU. For stable CIC expression, the CIC cDNA was subcloned into lentiviral vector (Flag-tagged) using Gateway system. CIC S173A mutant was generated using site-directed mutagenesis. Two independent oligos targeting CIC (sgCIC1: GCTCAGACACCAAGGCTCCG, sgCIC2: CCCCTCCGTGCAGCCGAGCG) were constructed and ligated into lentiCRISPR v2 (Addgene plasmid #52,961) for CIC depletion. pLenti CMV-SLC7A11-sh926R-FLAG-IRES-Hygro (Addgene plasmid #118,702) was used for xCT overexpression. The following reagents were used for in vitro treatments: monosodium glutamate (G1626, Sigma), R18 (2144, TOCRIS) and ( +)-MK801 maleate (HB0004, Hellobio).