The two best sgRNAs from the MitoPlus library were ordered as complementary oligonucleotides (Integrated DNA Technologies) and cloned into pLentiCRISPRv2 (Addgene no. 52961). An sgRNA (CTTGAGACTGAGTCAGACCA) targeting a non-expressed gene OR4N4 was used as a cutting negative control. Lentiviruses were produced according to Addgene’s protocol, and cells were selected with 2 µg ml−1 puromycin 24 h post-infection. Puromycin was withdrawn 48 h later, and cells were maintained for 10–20 additional days during which experiments were performed. Gene disruption efficiency was verified by protein immunoblotting. The sequences of the sgRNAs used are as follows: LDHD sg1 (AGGTTCGCGAGTCCTACCCA), LDHD sg2 (CACCGCGGCAGTGGACACGT), ATPAF2 sg1 (TGTCCATTACCAGATGGTGT) and ATPAF2 sg2 (TCTTTCTTACAGAAAGGAAG). The resulting KOs were evaluated by western blotting against LDHD (Sigma-Aldrich HPA0066148) with a dilution of 1:1,000.
Complementary oligonucleotides
Manufactured by Integrated DNA Technologies
Sourced in United States
Complementary oligonucleotides are short, synthetic DNA or RNA sequences that are designed to be complementary to a specific target sequence. They serve as essential tools for various molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Stellar chemically competent e coli cells, by Takara Bio (2 mentions)
Bpu1102i, by Thermo Fisher Scientific (2 mentions)
Bstxi, by New England Biolabs (2 mentions)
Plenticrisprv2, by Addgene (1 mentions)
Hifi dna assembly master mix, by New England Biolabs (1 mentions)
Streptavidin dynabeads, by Thermo Fisher Scientific (1 mentions)
Puromycin, by Thermo Fisher Scientific (1 mentions)
T7select 415 1 cloning kit, by Merck Group (1 mentions)
10 protocols using complementary oligonucleotides
1
Generating Knockout Cell Lines Using CRISPR
2
Cloning of sgRNA Expression Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Individual perfectly matched or mismatched sgRNAs were cloned essentially as described previously18 (link). Briefly, two complementary oligonucleotides (Integrated DNA Technologies), containing the targeting region as well as overhangs matching those left by restriction digest of the backbone with BstXI and BlpI, were annealed and ligated into an sgRNA expression vector digested with BstXI (NEB or Thermo Fisher Scientific) and BlpI (NEB) or Bpu1102I (Thermo Fisher Scientific). The ligation product was transformed into Stellar chemically competent E. coli cells (Takara Bio) and plasmid was prepared following standard protocols.
3
Plasmid Construction for CRISPR and Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR sgRNA constructs (Supplemental Table 1 ) were ordered as complementary oligonucleotides (Integrated DNA Technologies [IDT]), annealed, and cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9. pSin-HA-PHIP was constructed by subcloning a full-length PHIP-coding sequence (Morgan et al. 2017 (link)) into a modified version of pSin-EF2-Puro containing an N-terminal HA tag. For E.coli expression, PHIP-coding sequences (Supplemental Table 1 ) were synthesized by IDT and cloned into pET16b (Millipore Sigma 69662) using HiFi DNA assembly master mix (New England Biolabs E2621L). FLAG-tagged CUL4B was PCR-amplified using the pcDNA3-myc3-CUL4B plasmid as template and cloned into pcDNA5/FRT/TO (Thermo Fisher V652020). pX330-U6-Chimeric_BB-CBh-hSpCas9 was a gift from Feng Zhang (Addgene 42230) (Cong et al. 2013 (link)). pcDNA3-myc3-CUL4B was a gift from Yue Xiong (Addgene 19922) (Hu et al. 2008 (link)). pSin-EF2-Oct4-Pur was a gift from James Thomson (Addgene 16579) (Yu et al. 2007 (link)). pMD2.G was a gift from Didier Trono (Addgene 12259). psPAX2 was a gift from Didier Trono (Addgene 12260). pCAGGS-EGFP-IRES-Puro was a gift from Dr. Hitoshi Niwa.
4
Gli Binding Region Oligonucleotide Pulldown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PATCHED 1 promoter oligonucleotides were designed according to the location of a Gli binding region (GBR) at −2549 from the TSS site (GGAAGAAGTGTCAGTGTAAGAGTCTCCACGTGGGTGGTC AAGGCCATGGCTGCCTCACGG). 100 pmole of biotin-conjugated positive oligonucleotides and complementary oligonucleotides (Integrated DNA Technologies) were annealed in 1X TE/50 mM NaCl buffer in a PCR cycler and incubated with Dynabeads Streptavidin (M280, Invitrogen). FNPs, MXPs, or MNPs from day 5 control or ta2 embryos were pooled and processed as described for Western blotting. Cell lysates were incubated with oligonucleotides-bound Dynabeads at 4°C for 2 h. Beads were washed with 1 ml RIPA buffer three times and processed for Western Blotting analysis.
5
Synthesis of GST-MBP-His Fusion Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Constructs were produced by amplification of complementary oligonucleotides (Integrated DNA Technologies) to produce a full-length sequence containing 5′ Spe I and 3′ Bam HI restriction sites. These were cloned into the vector pJ307 (GST-MBP-His fusion vector) (30 (link)). To distinguish between the termination product and the trans-frame product, we present the MBP tag in the alternative −1 frame relative to the GST tag. MBP and GST were in frame for the positive control. Primers used in this study are provided separately in the Supplementary Materials.
6
Cloning of sgRNA Expression Vectors
7
CRISPR Gene Knockout Protocol Using Lentiviral Transduction
8
Phage Display Peptide Library Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nucleotide sequences encoding candidate peptides were cloned into T7 415-1b phage (Novagen, EMD Biosciences, USA) genomic DNA to be expressed on the phage surface as C-terminal fusions to capsid protein. The cloning was performed using complementary oligonucleotides (Integrated DNA Technologies, USA) as shown in the following Table 1. complementary oligonucleotides were diluted in milli-Q (MQ) water at 100 nM, heated at 80 °C for 10 min, and slowly cooled to room temperature for annealing. The cloning was performed according to the manufacturer's protocol using the T7Select® 415-1 Cloning Kit (#70,015-3, Millipore) with 1 μL of annealed oligonucleotides.
9
Cloning and Expression of Fusion Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The complementary deoxyribonucleic acid (cDNA) of PK was obtained by reverse-transcription polymerase chain reaction (RT-PCR) from mouse muscle RNA. The Luc2 sequence was amplified from the Luciferase2 plasmid, Promega (Madison, WI).
His-PK and His-Luc were generated by TA cloning of PK and Luc into pcDNA4/HisMax TOPO TA. To generate the His-Si4 vector, two complementary oligonucleotides (Integrated DNA Technologies, Inc. USA) encoding the Si4 sequence [22 (link)] with overhanging A were hybridized and cloned into the TA site of the pcDNA4/HisMax TOPO TA plasmid, followed by restriction/ligation of PCR fragments of PK and Luc to make His-Si4-plasmids. Subsequently, the Si4-PK and Si4-Luc sequences were amplified by PCR and inserted into pcDNA3.1 to make Si4-PK and Si4-Luc. Constructs were validated by sequencing and amplified in TOP10 cells and then purified.
His-PK and His-Luc were generated by TA cloning of PK and Luc into pcDNA4/HisMax TOPO TA. To generate the His-Si4 vector, two complementary oligonucleotides (Integrated DNA Technologies, Inc. USA) encoding the Si4 sequence [22 (link)] with overhanging A were hybridized and cloned into the TA site of the pcDNA4/HisMax TOPO TA plasmid, followed by restriction/ligation of PCR fragments of PK and Luc to make His-Si4-plasmids. Subsequently, the Si4-PK and Si4-Luc sequences were amplified by PCR and inserted into pcDNA3.1 to make Si4-PK and Si4-Luc. Constructs were validated by sequencing and amplified in TOP10 cells and then purified.
10
Plasmid construction for CRISPR-Cas9 system
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids SpCas9(BB)‐2A‐GFP (PX458), U6‐Chimeric_BB‐CBh‐SpCas9n‐D10A (PX335) and spCas9‐N863A (PX856) were a gift from Feng Zhang (Addgene plasmid #48138 and #42335, #62888, respectively). SpCas9‐D10A‐2A‐GFP was generated via ligation of an ApaI/AgeI‐digested fragment of plasmid PX335 into ApaI/AgeI‐digested PX458. SpCas9‐N863A‐2A‐GFP was generated via ligation of an EcoRV/BsmI‐digested fragment of plasmid PX856 into EcoRV/BsmI‐digested plasmid PX458. SpCas9‐D10A‐N863A‐2A‐GFP (nuclease‐dead Cas9) was generated via ligation of an EcoRV/BsmI‐digested fragment of plasmid Sp‐Cas9‐N863A‐2A‐GFP into EcoRV/BsmI‐digested plasmid SpCas9‐D10A‐2A‐GFP. To clone a target sequence into the PX backbones, two complementary oligonucleotides (Integrated DNA Technologies) with BbsI overhangs were phosphorylated, annealed and cloned in BbsI digested PX vectors as previously described (Cong et al, 2013 ). An overview of the targeted sequences can be found in Appendix Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!