Superrt cdna synthesis kit cdna

Total RNA from samples was isolated with Trizol reagent according to the manufacturer’s protocol (Sangon BioTech, Shanghai, China). One microgram (1 μg) of total RNA was reverse transcribed into cDNA using SuperRT cDNA Synthesis Kit cDNA (CW2569; CwBiotech, Beijing, China). Expression levels of miRNA-146a and COX-2 genes were evaluated by performing RT-PCR (Bio-Rad, Hercules, CA) analysis utilizing UltraSYBR Premix Ex TaqII Mixture (High ROX) (RR820A; Takara, Kusatsu, Japan). Primer sequences for miRNA-146a and COX-2 are presented in Table 2. Human U6 and GAPDH served as internal controls. Relative expression of miRNA-146a and COX-2 genes was calculated according to the 2^-ΔΔCt method.

Total RNA from the samples were isolated in the light of the protocol of Trizol reagent (Roche). One microgram (1 μg) total RNA was reversely transcribed into cDNA using SuperRT cDNA Synthesis Kit cDNA (CW Biotech, CW0741S, China). The level of Cox-2 gene was evaluated by performing real-time PCR utilizing UltraSYBR Mixture (High ROX) (CW Biotech, CW2602M, China). Primer sequences of Cox-2 are as follows: forward, AACGATCCCTCCCTTACCAT; reverse, GTTTAGACGTCCGGGAATTG. β-actin (forward, GATGAGATTGGCATGGCTTT; reverse, GTCACCTTCACCGTTCCAGT) served as the internal control. Relative expression of Cox-2 gene was calculated according to 2^−ΔΔCt method.