The largest database of trusted experimental protocols

Mir 195 5p inhibitor

Manufactured by GenePharma
Sourced in China

The MiR-195-5p inhibitor is a laboratory tool designed to suppress the activity of the microRNA molecule miR-195-5p. This inhibitor can be used in research applications to study the biological functions and regulatory roles of miR-195-5p in various experimental systems.

Automatically generated - may contain errors

2 protocols using mir 195 5p inhibitor

1

Melanoma Cell Line Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human melanoma A375 cells, M14 cells and HEK 293T cells were all purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China) and cultured in DMEM (Thermo Fisher Scientific), supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin and 100 μg/mL streptomycin (Thermo Fisher Scientific), at 37°C in a 5% CO2 incubator. MiR-497-5p mimics, miR- 497-5p inhibitor, miR-195-5p mimics, miR-195-5p inhibitor, miR-455-3p mimics, miR-455-3p inhibitor, mimics negative control (mimics NC) and inhibitor negative control (inhibitor NC) were synthesized and purchased from GenePharma Co, Ltd (Shanghai, China). The sequences are listed in Table S3. Human melanoma A375 cells with the concentration of 2×105 cells per well were seeded in 6-well plates and cultured for 24 h. Then miRNAs mimics/inhibitors/NC (50 nM) were transfected into the A375 cells using Lipofectamine 2000 (Thermo Fisher Scientific) in serum-free medium according to the manufacturer’s instructions.
+ Open protocol
+ Expand
2

Silencing Circular FURIN Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
si-circ-FURIN (si-circ-FURIN 1#: AACCAGTGTGCGAGGAAGGCT, si-circ-FURIN 2#: ACCAGTGTGCGAGGAAGGCTT), si-negative control (nc; UUCUCCGAACGUGUCACGUTT), miR-195-5p inhibitor (GCCAAUAUUUCUGUGCUGCUA) and negative control inhibitor (CAGUACUUUUGUGUAGUACAA), miR-195-5p mimic (UAGCAGCACAGAAAUAUUGGC) and negative control mimic (UUCUCCGAACGUGUCACGUTT), empty vector, and BCL2 overexpression vector were obtained from GenePharm (Shanghai, China). Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) was used for transient transfection following the manufacturer’s instrument. Forty-eight hours later, transfection efficiency was examined using RT-qPCR.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!