Opti mem 1

pCS2-mCherry was kindly provided by Dr. N. Kinoshita (NIBB). The hCas9 plasmid (pX330) was purchased from Addgene (Cambridge, MA). The hCas9 gene was excised from pX330, then placed downstream of the SP6 promoter in the pSP64 vector (Promega) (pSP64-hCas9) and used for RNA synthesis. pCS2-mCherry and pSP64-hCas9 were linearized by digestion with NotI and SalI, respectively, and used as templates for mCherry and hCas9 mRNA synthesis using an in vitro RNA transcription kit (mMESSAGE mMACHINE SP6 Transcription Kit, Ambion, Austin, TX), according to the manufacturer’s instructions.
A pair of oligos targeting Fgf10 or mCherry was annealed and inserted into the BsaI site of the pDR274 vector (Addgene). The sequences of the oligos were as follows: Fgf10 (5’-GGAGAGGACAAAAAACAAGA-3’) and mCherry (5’- GGCCACGAGTTCGAGATCGAGGG -3’). After digestion with DraI, gRNAs were synthesized using the MEGAshortscript T7 Transcription Kit (Ambion, Austin, TX). The synthesized mRNAs and gRNAs were purified by phenol-chloroform-isoamylalcohol extraction and isopropanol precipitation. The precipitated RNA was dissolved in Opti-MEM I (Life Technologies) at 2–4 μg/μl, and stored at –20 °C until use. RNAs were quantified by absorption spectroscopy and agarose gel electrophoresis. The ssODNs were purchased from Sigma in dry form, dissolved in Opti-MEM I to 1 μg/μl, and stored at –20 °C until use.