Master mix sybr green one

To examine the gene expression of SDF-1α and VEGF in ischemic myocardium (n = 4), the total RNA were prepared by homogenizing tissue with TRIzol Reagent (Invitrogen, Carlsbad, CA). For reverse-transcription polymerase chain reaction, 1ug of total RNA was added to the reaction system according to manufacturer’s guideline (Promega, Madison, WI).The resulting cDNA was used as template in PCR with cDNA specific primers spanning at least one intron. The primers are listed in Table 1. For the RT reaction, the reaction condition was denaturation for 10 minutes at 70°C followed by 15 minutes at 42°C and 5 minutes at 95°C.For quantitative real-time PCR, 4 uL cDNA diluted 20-fold was used with Master Mix SYBR Green One (Applied Biosystems, Carlsbad, CA) and normalized to GAPDH.

To examine the gene transcription expression of SDF‐1α, the borderline zone of ischaemic myocardium was harvested at 3, 7 and 14 days after the procedure (n = 4) 8. Total RNA was isolated using TRIzol Reagent (Invitrogen). For reverse transcription polymerase chain reaction (PCR), 1 μg of total RNA was added to the reverse transcription system (Promega, Madison, WI, USA). The reaction conditions were denaturation for 10 min. at 70°C followed by 15 min. at 42°C and 5 min. at 95°C. The resulting cDNA was used as the template in PCR with cDNA‐specific primers spanning at least one intron. The following oligonucleotides were used as primers (Takara Biotechnology Co., Dalian, China): for SDF‐1α: Forward, 5′‐TGAGAGCCATGTCGCCAGA‐3′, and Reverse, 5′‐GGATCCACTTTAATTTCGGGTCAA‐3′; for GAPDH: Forward, 5′‐GGCACAGTCAAGGCTGAGAATG‐3′, and Reverse 5′‐ATGGTGGTGAAGACGCC AGTA‐3′. For quantitative real‐time PCR, 4 μl cDNA diluted 20‐fold was used with Master Mix SYBR Green One (Applied Biosystems, Carlsbad, CA, USA) and normalized to GAPDH.