SICs were resuspended in PBS and plated onto BHI, BHI-S, or GAM plates. Plates were incubated at 37 °C in an anaerobic chamber. After 2 days, colonies were grown in the medium corresponding to the plate from which they were isolated for 2 days, and glycerol stocked. Strains were identified via high-throughput MALDI-TOF mass spectrometry of whole colonies, and subsequent matching of spectra to a reference library with a MALDI Biotyper System (Bruker), following manufacturer’s instructions and including formic acid lysis. 15 distinct strains were obtained and their taxonomy was checked by Sanger sequencing. Genomic DNA was extracted from pure cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen 10196–4) or DNeasy Blood and Tissue Kit (Qiagen 69504) kit. The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA, and the amplicon was Sanger sequenced. Taxonomic assignment was performed by alignment using BLAST against the 16S ribosomal RNA sequences (Bacterial and Archaea) database.
Dneasy ultraclean 96 microbial kit
Manufactured by Qiagen
Sourced in Germany
The DNeasy UltraClean 96 Microbial Kit is a high-throughput DNA extraction and purification system designed for efficient isolation of genomic DNA from a variety of microbial sources. The kit utilizes a bead-beating and spin-column technology to ensure reliable and consistent DNA recovery.
Automatically generated - may contain errors
Lab products found in correlation
Dneasy blood and tissue kit, by Qiagen (1 mentions)
Maldi biotyper system, by Bruker (1 mentions)
Ultraclean 96 pcr cleanup kit, by Qiagen (1 mentions)
Quant it dsdna high sensitivity assay kit, by Thermo Fisher Scientific (1 mentions)
5prime hotmastermix, by Quantabio (1 mentions)
Platinum 2 hot start pcr master mix, by Thermo Fisher Scientific (1 mentions)
Bcl2fastq v2, by Illumina (1 mentions)
Miseq platform, by Illumina (1 mentions)
2100 bioanalyzer instrument, by Thermo Fisher Scientific (1 mentions)
Nd one w, by Thermo Fisher Scientific (1 mentions)
Miniseq high output kit, by Illumina (1 mentions)
Nextera xt dna library preparation kit, by Illumina (1 mentions)
Hiseq 4000, by Illumina (1 mentions)
Dneasy powersoil htp 96 kit, by Qiagen (1 mentions)
Dneasy 96 blood and tissue kit, by Qiagen (1 mentions)
6 protocols using dneasy ultraclean 96 microbial kit
1
Isolation and Identification of Anaerobic Bacterial Strains
2
16S rRNA Amplicon Sequencing from Fecal/Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA from fecal samples or 50 μL of saturated bacterial cultures were extracted using an extraction kit such as the DNeasy UltraClean 96 Microbial Kit (Qiagen, 10196-4). Three microliters of extracted gDNA were used for PCR in 75-μL volumes containing Earth Microbiome Project-recommended 515F/806R primer pairs (0.4 μM final concentration) and a polymerase such as that of the 5PRIME HotMasterMix (Quantabio, 2200410) to generate V4 region 16S rRNA amplicons. The following thermocycler conditions were used: 94°C for 3 min, 35 cycles of [94°C for 45 s, 50°C for 60 s, and 72°C for 90 s], then 72°C for 10 min. PCR products were individually cleaned up and quantified using the UltraClean 96 PCR Cleanup Kit (Qiagen, 12596-4) and the Quant-iT dsDNA High Sensitivity Assay kit (Invitrogen, Q33120) before 200 ng of PCR product for each sample were manually pooled. Pooled libraries were then sequenced with 250- or 300-bp paired-end reads on a MiSeq (Illumina).
3
Dolphin Oral Microbiome Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fifty-four dolphin oral samples were selected for 16S rRNA gene amplicon sequencing. Genomic DNA was extracted from dolphin oral samples and 32 negative (PBS) controls using the DNeasy UltraClean 96 Microbial Kit (Qiagen Cat. #10196-4) following manufacturer’s instructions. The 16S rRNA V4 region was amplified using 515F and 806rB primers using Platinum™ II HotStart PCR Master Mix (ThermoFisher Cat. #14000013). The PCR products were pooled at equal volume and gel-purified. Final purification was performed using Macherey-Nagel NucleoSpin Gel and PCR Clean-up, Mini Kit (Fisher, Cat. #740609). Amplicons were sequenced on the Illumina MiSeq platform with 250-bp paired reads at the Stanford Chan Zuckerberg Biohub Facility, resulting in a median read depth of 92,077 reads (min: 50,772, max: 265,108).
Demultiplexing was performed using Bcl2Fastq v. 2 (Illumina, CA, USA). ASVs were inferred using DADA271 (link) v. 1.16.0, following guidelines in the “Big Data Workflow” (https://benjjneb.github.io/dada2/bigdata_paired.html ). Taxonomic affiliations were assigned using the SILVA 138 SSU database72 (link) as a reference. Forward and reverse reads were trimmed to 240 and 180 nt, respectively. This pipeline yielded a total of 1116 taxa and 5,339,751 reads across the 54 samples. ASVs were analyzed using phyloseq v. 1.28.072 (link).
Demultiplexing was performed using Bcl2Fastq v. 2 (Illumina, CA, USA). ASVs were inferred using DADA271 (link) v. 1.16.0, following guidelines in the “Big Data Workflow” (
4
Microbial DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
L5-L6 DNA was extracted again, using DNeasy UltraClean 96 Microbial Kit [Qiagen, Hilden, Germany]. A Nanodrop device [ND-ONE-W] was used to control purity and concentration for each sample [Thermofisher, Waltham, USA]. The Qiagen kit allows to obtain good quality purified DNA as assessed by a 280/260 and 260/230 ratio close to 2 and the concentration of the DNA was sufficient to perform library preparation on some samples [concentration 100 ng/μl].Samples were prepared for further sequencing. Library was produced using the Nextera XT DNA Library Preparation kit [Illumina, San Diego, USA]- with a control of the fragment size on a 2100 Bioanalyzer Instrument [Thermofisher, Waltham, USA]. Sequencing was performed using the Miniseq High Output Kit [Illumina, San Diego, USA] generating paired-end reads of 150 bp. Quality of reads was then analyzed by fastqc and a combination of web-based analysis (TB-Profiler) (available at https://tbdr.lshtm.ac.uk ) or through a proprietary pipeline (TB-Annotator)[16 ].
5
Whole-Genome Sequencing of Bacterial Populations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Populations were revived overnight from frozen in liquid Luria Bertani broth at 37 °C. Genomic DNA was extracted for whole-genome sequencing from samples using the MO BIO Ultraclean 96 Microbial DNA kit (now sold as QIAGEN DNeasy UltraClean 96 Microbial kit), following the manufacturer’s recommended protocol. Library preparation and sequencing were performed by Genome Quebec at McGill University on the Illumina HiSeq 4000 platform, using paired-end sequencing of 2 × 100 base-pair reads.
6
Fecal gDNA Extraction for 16S Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
gDNA from ∼30 mg of human fecal samples (dry or resuspended in PBS) or 50 μL of bacterial cultures were extracted using the DNeasy PowerSoil HTP 96-kit (Qiagen, 12955-4), the DNeasy UltraClean 96 Microbial Kit (Qiagen, 10196-4), or the DNeasy 96 Blood and Tissue Kit (Qiagen, 69581) following the manufacturers’ protocols. All other aspects of the standard 16S rRNA sequencing library preparation protocol described in the section above were then followed.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!