The largest database of trusted experimental protocols

7 protocols using sigenome non targeting pool 2

1

Rab5 and Rab11A Silencing in CFBE41o- Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transfection of CFBE41o- cells with siRNA targeting human Rab5 gene (siRab5, siGENOME Human Rab5 siRNA; Dharmacon, Cambridge, United Kingdom), human Rab11A gene (siRab11 Accell Human Rab11A siRNA; Dharmacon) or non-targeting siRNA (siCTRL, siGENOME Non-Targeting Pool #2; Dharmacon) was performed using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions. CFBE41o- cells were plated on collagen-coated cell culture plates and incubated with the optimized transfection mixture containing 50 nM of siRNA, at 37°C for 24 h. Next day, cells were transferred to collagen-coated Transwell filters for 5 days to allow cell polarization. Experiments were conducted 6 days after siRNA transfection.
+ Open protocol
+ Expand
2

Reverse Transfection of HCMV siRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols
For reverse transfection of siRNAs, pools of four different siRNAs (siGENOME Dharmacon) per target were complexed with Lipofectamine RNAiMAX (Life Technologies) in 96-well plates. HFFs and EA.hy926 cells were added at a density of 10,000 cells per well. A highly efficient HCMV-IE siRNA [62 ] (Sigma-Aldrich) served as a positive control and the siGENOME non-targeting pool #2 (Dharmacon) was used as a negative control. Duplicate wells of all conditions were prepared. Two days posttransfection, cells were infected with HCMV-TB40/E at a multiplicity of infection (MOI) 1. The next day, cells were fixed with 80% acetone and stained for viral IE antigens.
+ Open protocol
+ Expand
3

Antibody Validation and siRNA Knockdown for DNA Repair Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following antibodies were used in this study at the indicated dilutions: anti-CIP2A (CST #14805; 1 : 1000), anti-GAPDH (Sigma-Aldrich G9545; 1 : 20 000), anti-GFP (gift from Laurence Pelletier, 1 : 10 000), anti-KAP1 (Bethyl A300-274A, 1 : 5000), anti-POLE3 (Bethyl A301-245A-1; 1 : 2000), anti-POLE4 (Abcam ab220695; 1 : 200), anti-Tubulin (Millipore CP06, 1 : 2000), anti-pCHK1 (S345) (Cell Signaling #2348, 1 : 1000), anti-CHK1 (Santa Cruz sc8408, 1 : 500), anti-pRPA32 (S33) (Bethyl A300-246A-3, 1 : 20 000), anti-RPA32 (Abcam ab2175, 1 : 500). The following secondary antibodies for immunoblotting were used in this study: peroxidase-conjugated AffiniPure Bovine Anti-Goat IgG (Jackson Immuno Research 805-035-180) and peroxidase-conjugated Sheep Anti Mouse IgG (GE Healthcare NA931 V). All peroxidase-conjugated secondary antibodies were used at a dilution of 1 : 5000. Protein bands were detected using the SuperSignal West Pico enhanced chemiluminescence reagent (Thermo Fisher Scientific). The following siRNAs from Dharmacon were used in this study: control, siGENOME Non-targeting Pool #2 (D-001206-14-05); POLE3, siGENOME SMARTpool (M-008460-01-0005); POLE4, siGENOME SMARTpool (M-009850-01-0005); APEX2, siGENOME SMARTpool (M-013730-00-0005). ATR inhibitors VE-821 and AZD6738 were purchased from SelleckChem.
+ Open protocol
+ Expand
4

LMTK2 Gene Silencing in CFBE41o- Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Transfection of CFBE41o- cells with siRNA targeting human LMTK2 gene (siLMTK2, siGENOME Human LMTK2 siRNA; Dharmacon, Cambridge, UK) or non-targeting siRNA (siCTRL, siGENOME NonTargeting Pool #2; Dharmacon) was performed using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions. CFBE41o- cells were plated on collagen-coated cell culture plates and incubated with the optimized transfection mixture containing 50nM of siRNA, at 37°C for 24 h. Next day, culture medium was changed to remove FBS and transfection mixture. Experiments were conducted 2 days after siRNA transfection.
+ Open protocol
+ Expand
5

Knockdown of Protein Expression by siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 3

Knockdown of Protein Expression by siRNA:

For reverse transfection of siRNAs, cells were seeded at a density of 10,000 per well. As a negative control the inventors used siGenome non-targeting pool #2 (Dharmacon), as a positive control served a highly efficient IE siRNA (Hochdorfer 2016). Targets were knocked down with pools of four different siRNAs (siGenome Dharmacon). For each transfection using Lipofectamin RNAiMAX (Life Technologies) a final concentration of 50 nM was applied. 48 h post transfection HCMV TB40/E was added to the cells at a multiplicity of 0.5 to 1. Infection was allowed for 1 day before cells were fixed and stained for viral immediate early antigens.

+ Open protocol
+ Expand
6

Ectopic Expression of LANA and Mre11

Check if the same lab product or an alternative is used in the 5 most similar protocols
Full-length LANA was expressed from a vector with the pcDNA3.1 backbone. Human Mre11 was expressed by transfecting a plasmid purchased from Addgene (plasmid # 82033) and the corresponding empty vector (plasmid # 46960) was used as a control. Adherent cells were transfected using Fugene6 (Promega, E269A) according to the manufacturer’s instructions. Cells were stimulated with naked DNA (ISD Naked, InvivoGen, tlrl-isdn) by transfection with Lipofectamine2000 (Invitrogen by Life Technologies, 11668–027), using the conditions indicated in the figure legends. siRNAs were purchased from Dharmacon: human Mre11 custom siRNA pool (#1: ccugccucgaguuauuaaguu; #2: cugcgaguggacuauaguguu; #3 gaugccauugaggaauuaguu), siGENOME Non-Targeting Pool#2 (D-001206-14-50). siRNAs were prepared according to the manufacturer’s instructions and transfected at the concentrations indicated in the figure legends using the Neon transfection system (Thermo-Fischer Scientific) under the following microporation conditions: 1150V, 30ms, 2 pulses.
+ Open protocol
+ Expand
7

siRNA Transfection for Cell Coculture

Check if the same lab product or an alternative is used in the 5 most similar protocols
siGENOME non targeting pool #2 and human IP-10 ON-TARGETplus SMART pool were purchased from Dharmacon (Thermo Scientific) and siRNA transfections were performed following the manufacturer's instructions. Briefly, cells were seeded in 6-well plate in complete media overnight followed by the addition of siRNA mixed with INTERFERin (Polyplus Transfection). The cells were further incubated 24 hr before being plated for coculture experiments.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!