Pclamp 10.4 package

The coding sequence of Rdl was PCR-amplified using pecific primers designed based on the synganglion transcriptome assembly (Iri-RDL-F0 GGTCAAGGAGGTCGCTTGCC; Iri-RDL-R0 ACGACAACTTTAAAGGCGAATGC, FuIri-RDL-ptb-XhoF AGCGATGGCGTTCAGTTGCTG; FuIri-RDL-ptb-ApaR GACCGTGTGCACTATTCGTCG). The Rdl PCR-product was subcloned into the transcription vector pTB-207 [56 (link)] using the In-Fusion® HD Cloning Kit (Clontech™) and cRNAs were synthesized with the T7 mMessage mMachine kit (Ambion™). Expression of GABA-Rdl in Xenopus laevis oocytes and two-electrode voltage clamp electrophysiology were carried out as described previously [57 (link)]. Briefly, 36 nL of 700 ng/μL Rdl cRNAs were micro-injected into defolliculated Xenopus oocytes (Ecocyte Bioscience) using a Drummond Nanoject II microinjector and incubated 3 days at 19 °C to allow subunit expression. Electrophysiological recordings were performed using an Oocyte Clamp OC-725C amplifier (Warner Instruments) under voltage clamp at − 60 mV and analyzed using the pCLAMP 10.4 package (Molecular Devices).

To investigate the functional expression of the mutated LEV-1 or UNC-29 subunits, C. elegans L-type nicotinic receptors, either with wild type or modified subunits, were reconstituted in Xenopus laevis oocytes and assayed under voltage-clamp as previously described [92 (link)]. Briefly, 36 nl of cRNA mix were microinjected in defolliculated Xenopus oocytes (Ecocyte Bioscience) using a Nanoject II microinjector
(Drummond). After 4 days incubation, BAPTA-AM-treated oocytes were voltage-clamped at a holding potential of -60 mV and electrophysiological recordings were carried out as described previously [92 (link)]. Whole cell acetylcholine current responses were collected and analysed using the pCLAMP 10.4 package (Molecular Devices).

The lupanine and alkaloid extracts from lupin seeds were perfused on defolliculated X. laevis oocytes (Ecocyte Bioscience, Dortmund, Germany) expressing either the C. elegans nicotine-sensitive nAChR subtype (Cel-N-nAChR, encoded by acr-16^{53 (link)}), or its levamisole-sensitive counterpart (Cel-L-nAChR, encoded by unc-38, unc-63, unc-29, lev-1 and lev-8^{53 (link)}). In the lack of H. contortus nicotine-sensitive AChR described, the sole levamisole-sensitive nAChR subtype 1 (Hco-L-nAChR1, encoded by unc-29.1, unc-38, unc-63 and acr-8^{29 (link)}) from H. contortus was also expressed. Expression of recombinant nAChRs was achieved by microinjection of cRNAs into the oocyte cytoplasm and two-electrode voltage-clamp recordings were carried out as previously described^{29 (link)}.
Acetylcholine was applied first to check for the presence of functional nAChRs and for current normalization in presence of lupanine or alkaloid extracts. Antagonist modulation of acetylcholine-elicited current was determined by pre-application of lupanine or alkaloid extracts for 10 seconds, followed by their co-application in the presence of acetylcholine.
Data were collected and analysed using pCLAMP 10.4 package (Molecular Devices, UK).