Tr30021v

Manufactured by OriGene

Sourced in United States

TR30021V is a laboratory equipment product offered by OriGene. It is a core laboratory instrument designed to perform specific tasks, but a detailed description is not available while maintaining an unbiased and factual approach.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions) D 001810, by Horizon Discovery (2 mentions) Human rala tl309957v, by OriGene (2 mentions) Ralb tl309956v, by OriGene (2 mentions) Sc 41843, by Santa Cruz Biotechnology (2 mentions) Rmm4532 e eg50523, by Horizon Discovery (2 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions) Polybrene, by Merck Group (1 mentions) Puromycin, by Merck Group (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Antibiotics and antimycotic, by Thermo Fisher Scientific (1 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions) Rapamycin, by Merck Group (1 mentions) Tc20 cell counter, by Bio-Rad (1 mentions) Puromycin, by Santa Cruz Biotechnology (1 mentions) Dual luciferase reporter assay system, by Promega (1 mentions) Pspax2, by Addgene (1 mentions) Pmd2 g, by Addgene (1 mentions)

Spelling variants of this product

TR30021V shRNA scramble control particles (2 citations)

9 protocols using tr30021v

Knockdown of RALA and RALB in Breast Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

MDA-MB-231 and MDA-MB-468 human breast carcinoma cell lines were acquired from ATCC and cultured in RPMI 1640 medium. MVT1 mouse mammary tumor cells have been described previously [23 (link)] and were grown in DMEM medium. Media contained 10% fetal bovine serum (FBS), 2% pen strep, 1% l-glutamine. Cells were kept at 37°C with 5% CO₂.
Small interfering RNA (siRNA)-mediated knockdown of RALA and RALB was achieved through the transfection of MDA-MB-231 or MDA-MB-468 cells with 50 pMol of siRNA targeting human RALA (GCAGACAGCUAUCGGAAGA; Dharmacon, Lafayette, CO, USA), RALB (GAAAGAUGUUGCUUACUAU, Dharmacon) or simultaneously targeting both isoforms (GAGCUAAUGUUGACAAGGU; Dharmacon) or non-targeting control siRNA pool (D-001810-10-05, Dharmacon) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA) for 72 h.
Human RALA (TL309957V) and RALB (TL309956V) targeting shRNA lentiviral particles and a non-targeting control (TR30021V) were purchased from OriGene (Rockville, MD, USA). MDA-MB-231 cells were transduced with lentiviral particles and selected using 5 μg/mL puromycin for > 7 days. Similarly, mouse RALA targeting shRNA lentiviral particles and a non-targeting control (sc-41843; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were used to achieve knockdown of RalA in MVT1 cells. Again, cells underwent selection in puromycin-containing medium for > 7 days.

Thies K.A., Cole M.W., Schafer R.E., Spehar J.M., Richardson D.S., Steck S.A., Das M., Lian A.W., Ray A., Shakya R., Knoblaugh S.E., Timmers C.D., Ostrowski M.C., Chakravarti A., Sizemore G.M, & Sizemore S.T. (2021). The small G-protein RalA promotes progression and metastasis of triple-negative breast cancer. Breast Cancer Research : BCR, 23, 65.

+ Open protocol

+ Expand

Lentiviral Microinjection into Rat Atrioventricular Groove

Check if the same lab product or an alternative is used in the 5 most similar protocols

Under surgical anesthesia (2% isoflurane) and mechanical ventilation, rats were kept in right lateral recumbent position. A left posterolateral thoracotomy was done through the third left intercostal space on the back, and the left lung was moved aside to expose the AVG. There was a white color epicardial adipose pad at the junction of the inferior pulmonary veins and left atrium, which served as a marker for the virus microinjection because the AVG is located in this pad (Figure 1A). The heart beating was very weak at the junction of the inferior pulmonary veins and left atrium when the AVG was exposed under the left posterolateral thoracotomy, which ensured the success of the virus microinjection into the AVG. Under the microscope, lentiviral rat Ca_v2.2‐α shRNA with phosphorylated green fluorescent protein (pGFP) or shRNA scramble control (2 μL, 2.0×10⁷ pfu/mL, TL713159V and TR30021V, OriGene Technologies, Rockville, MD) was microinjected into the epicardial adipose pad by a glass micropipette connected to a WPI Nanoliter 2000 microinjector (Figure 1A). Scrambled shRNA was used to assess possible toxicity of lentivirus. After transfection, the chest was closed, and experiments were performed 1 week later to guarantee degradation of existing Ca_v2.2‐α protein.

Zhang D., Tu H., Cao L., Zheng H., Muelleman R.L., Wadman M.C, & Li Y. (2018). Reduced N‐Type Ca2+ Channels in Atrioventricular Ganglion Neurons Are Involved in Ventricular Arrhythmogenesis. Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease, 7(2), e007457.

+ Open protocol

+ Expand

Lentiviral Knockdown of KDM5D in SAS and FaDu Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

KDM5D was knocked down in SAS and FaDu cells by using a lentiviral approach. A short hairpin RNA (shRNA) construct was purchased from Origene TR30021V (Cat#: TL309236V). Lentiviruses containing constructs targeting KDM5D or scrambled controls were generated by transfecting HEK293T cells with Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA, USA). The viral supernatant was used to transduce SAS or FaDu cells in the presence of polybrene (4 μg/mL; Sigma-Aldrich, St Louis, MO, USA). The transduced cells were selected in a medium containing puromycin (3 μg/mL, Sigma-Aldrich, St. Louis, MO, USA), and the knockdown efficiency was determined through immunoblotting.

Chen T.M., Huang C.M., Setiawan S.A., Hsieh M.S., Sheen C.C, & Yeh C.T. (2023). KDM5D Histone Demethylase Identifies Platinum-Tolerant Head and Neck Cancer Cells Vulnerable to Mitotic Catastrophe. International Journal of Molecular Sciences, 24(6), 5310.

+ Open protocol

+ Expand

Modulating mTOR, NF-κB Signaling in HEK293

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Gibco), and antibiotics and antimycotics (Invitrogen), and were counted using a TC-20 cell counter (Bio-Rad). Cells were transfected with 50 nM of control siRNA (siCTRL) or siRNAs targeting mTOR, NF-κB1 or RelA using Lipofectamine 2000 (Thermo Fisher Scientific). Lentiviral particles delivering either GRSF1-specific (TL312593V, OriGene) or scrambled control (TR30021V, OriGene) shRNA were transduced into HEK293 cells in the presence of 8 μg/mL of Polybrene with a MOI (Multiplicity of infection) of 20. Three days after transduction cells were maintained in culture media supplemented with 3 μg/mL of Puromycin (Santa Cruz Biotechnology). Rapamycin (R8781, Sigma) was added into the culture medium of HEK293 cells (25 or 50 nM).
HEK293 cells stably expressing RelA (LR-7008)- or IL-6 (SL-0048-NP)-responsive luciferase reporter were purchased (Signosis), and the luciferase activity was determined by Dual-Luciferase^® reporter assay system according to the manufacturer's instruction (Promega).

Noh J.H., Kim K.M., Pandey P.R., Noren Hooten N., Munk R., Kundu G., De S., Martindale J.L., Yang X., Evans M.K., Abdelmohsen K, & Gorospe M. (2019). Loss of RNA-binding protein GRSF1 activates mTOR to elicit a proinflammatory transcriptional program. Nucleic Acids Research, 47(5), 2472-2486.

+ Open protocol

+ Expand

Lentiviral Transduction of NRDE2 and CEP131

Check if the same lab product or an alternative is used in the 5 most similar protocols

Generation two lentiviral constructs (0.75 µg of pMD2.G [Addgene plasmid 12259] and 0.75 µg psPAX2) (Addgene plasmid 12260) and 1.5 µg of either NRDE2-mGFP expression plasmid (Origene RC224847L2) or a dox-inducible 3xFLAG-CEP131 construct (a kind gift from L. Shi, Tianjin Medical University), were transfected into HEK293T cells in 6-well plates with Lipofectamine 3000. Media was changed after 6 h and viral supernatant was collected 36—48 h later, 0.2 µm filter sterilized and frozen at −80°C. For NRDE2 expression, HEK293T and MDA-MB-231 cells were infected with either control GFP (Origene TR30021V) or NRDE2-GFP lentiviral supernatant. GFP-positive cells were sorted by flow cytometry ∼1 wk post-infection. For generating stable dox-inducible 3XFLAG-CEP131 expressing lines, infected MDA-MB-231 cells were selected and maintained in 1.5 µg/mL of Puromycin.

Jiao A.L., Perales R., Umbreit N.T., Haswell J.R., Piper M.E., Adams B.D., Pellman D., Kennedy S, & Slack F.J. (2019). Human nuclear RNAi-defective 2 (NRDE2) is an essential RNA splicing factor. RNA, 25(3), 352-363.

+ Open protocol

+ Expand

Mitochondrial Dynamics Regulation in HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

For shRNA treatment, HeLa cells were transduced with MFN2-human shRNA lentiviral particles (TL311490VA_ GAGGTTCTTGACTCACTTCAGAGCAAA GC or TL311490VB_ TCAAGTGAGGATGTTTGAGTTTCAGAATT). A scrambled lentiviral shRNA was used as the negative control for MFN2 knockdown (TR30021V; OriGene, Korea).

Ahn S.Y., Song J., Kim Y.C., Kim M.H, & Hyun Y.M. (2021). Mitofusin-2 Promotes the Epithelial-Mesenchymal Transition-Induced Cervical Cancer Progression. Immune Network, 21(4), e30.

+ Open protocol

+ Expand

Silencing RalA and RalB in Breast Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

MDA-MB-231 and MDA-MB-468 human breast carcinoma cell lines were acquired from ATCC and cultured in RPMI 1640 medium. MVT1 mouse mammary tumor cells have been described previously [23] and were grown in DMEM medium. Media contained 10% fetal bovine serum (FBS), 2% pen strep, 1% L-glutamine. Cells were kept at 37˚C with 5% CO 2 .
Small interfering RNA (siRNA)-mediated knockdown of RALA and RALB was achieved through the transfection of MDA-MB-231 or MDA-MB-468 cells with 50 pMol of siRNA targeting human RALA (GCAGACAGCUAUCGGAAGA; Dharmacon, Lafayette, CO, USA), RALB (GAAAGAUGUUGCUUACUAU, Dharmacon) or simultaneously targeting both isoforms (GAGCUAAUGUUGACAAGGU; Dharmacon) or non-targeting control siRNA pool (D-001810-10-05, Dharmacon) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA) for 72 hours.
Human RALA (TL309957V) and RALB (TL309956V) targeting shRNA lentiviral particles and a non-targeting control (TR30021V) were purchased from OriGene (Rockville, MD, USA). MDA-MB-231 cells were transduced with lentiviral particles and selected using 5 µg/mL puromycin for > 7 days. Similarly, mouse RALA targeting shRNA lentiviral particles and a non-targeting control (sc-41843; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) were used to achieve knockdown of RalA in MVT1 cells. Again, cells underwent selection in puromycin-containing medium for > 7 days.

Thies K., Cole M.W., Schafer R., Spehar J.M., Richardson D.S., Steck S.A., Das M., Lian A.W., Ray A., Shakya R., Knoblaugh S.E., Timmers C., Ostrowski M.C., Chakravarti A., Sizemore G.M., & Sizemore S.T. (2021). The Small G-Protein RalA Promotes Progression and Metastasis of Triple Negative Breast Cancer.

+ Open protocol

+ Expand

Lentiviral Knockdown of Hippo Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols

LATS1 and 2 knock-down was achieved using GIPZ lentivirus specific for mouse LATS1 or 2 mRNA (Dharmacon #RMM4532-E-EG50523, and #RMM4532-EG16798).
Knock-down of YAP or TAZ was achieved by lentiviral delivery of shRNA encoded by pRRL.SFFV.GFP.mirE.PGK.Neo.Yap1.891 and pRRL.SFFV.GFP.mirE.PGK.Neo.Wwtr1.1533 respectively (a kind gift from Dr. Lukas Edward Dow). A lentiviral-based non-targeting shRNA control was purchased from Origene (Origene #TR30021V).
Transduced cells were selected based on GFP expression (selection marker encoded by the lentivirus delivered DNA), and single clones for YAP, TAZ, or LATS1/2 shRNA knock-down were established for downstream experiments.

Drozdz M.M., Doane A.S., Alkallas R., Desman G., Bareja R., Reilly M., Bang J., Yusupova M., You J., Eraslan Z., Wang J.Z., Verma A., Aguirre K., Kane E., Watson I.R., Elemento O., Piskounova E., Merghoub T, & Zippin J.H. (2022). A nuclear cAMP microdomain suppresses tumor growth by Hippo pathway inactivation. Cell reports, 40(13), 111412.

+ Open protocol

+ Expand

Lentiviral Knockdown of Hippo Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!