Lentiviral inserts were PCR amplified from genomic DNA using a nested PCR protocol with outer primers targeting the virus backbone16 (link) and custom inner primers with binding sequences for Illumina Nextera adaptor read1 and read2 attached to the 5′-ends. After product purification using a PCR cleanup kit (Macherey and Nagel), a third PCR using Illumina Nextera indexing primers (N7xx and S5xx) produced the final sequencing libraries that were diluted, pooled, and sequenced on a HiSeq2500 (Illumina) with paired-end 125 bp read length, and v4 sequencing chemistry. The sequencing was done at the SciLife core facility at Uppsala University. The primers are listed in Supplementary Table 1 .
Nextera indexing primers
Manufactured by Illumina
Sourced in United States
Nextera Indexing Primers are a set of oligonucleotide sequences used in Illumina's Nextera library preparation workflow. These primers enable the addition of sample-specific indices to DNA fragments, allowing for simultaneous sequencing of multiple samples in a single sequencing run.
Automatically generated - may contain errors
Lab products found in correlation
Hifi hotstart readymix, by Roche (3 mentions)
Pcr cleanup kit, by Illumina (1 mentions)
Hiseq 2500, by Illumina (1 mentions)
Mutanolysin, by Merck Group (1 mentions)
Dna and viral na small volume kit, by Roche (1 mentions)
Lysostaphine, by Merck Group (1 mentions)
Lysozyme l4919, by Merck Group (1 mentions)
Rprotksol ro, by Merck Group (1 mentions)
Td buffer, by Illumina (1 mentions)
Hifi hot start polymerase, by Roche (1 mentions)
Nextera dna library prep kit, by Illumina (1 mentions)
Kapa hifi hotstart readymix, by Illumina (1 mentions)
Tagment dna buffer, by Illumina (1 mentions)
Hifi polymerase, by Roche (1 mentions)
9 protocols using nextera indexing primers
1
Lentiviral Inserts Sequencing Protocol
2
Comprehensive Microbial Profiling via 16S rRNA and tuf Gene Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from swabs using an enzymatic prelysis step (30 min incubation at 37 °C with an enzyme solution containing 4 U lysostaphine (SAE0091), 25 U mutanolysin (sae0092), and 3 mg lysozyme (L4919) (Sigma-Aldrich, St. Louis, MO, USA); then 30 min incubation at 56 °C with 20 µL protein kinase K (RPROTKSOL-RO, Sigma-Aldrich, St. Louis, MO, USA), followed by DNA extraction on a MagNa-Pure 96 robot using a DNA and Viral NA Small Volume Kit (Roche, Mannheim, Germany).
The V3-V4 region of the 16S rRNA gene and that of the tuf gene were amplified in two separate PCRs (95 °C for 3 min; 25 cycles of 98 °C for 20 s, 60 °C for 15 s, 72 °C for 45 s; 72 °C for 5 min), using primers (16SrRNA: 341F: 5′- CCTACGGGNGGCWGCAG -3′; 805R: 5′- GACTACHVGGGTATCTAATC-3′; tuf: F: 5′- CAGAAGAAAAAGAACGTGG-3′; R: 5′- GTCCTCAACWGGCATCA-3′) with preceding heterogeneity spacers [23 (link),24 (link)]. Amplicon libraries were constructed using nextera indexing primers (Illumina Inc., San Diego, CA, USA) (PCR program used: 95 °C for 3 min; 20 cycles of 98 °C for 20 s, 55 °C for 15 s, and 72 °C for 45 s; 72 °C for 5 min) and sequenced on a MiSeq instrument using a 600 cycle V3 kit (Illumina Inc., San Diego, CA, USA).
The V3-V4 region of the 16S rRNA gene and that of the tuf gene were amplified in two separate PCRs (95 °C for 3 min; 25 cycles of 98 °C for 20 s, 60 °C for 15 s, 72 °C for 45 s; 72 °C for 5 min), using primers (16SrRNA: 341F: 5′- CCTACGGGNGGCWGCAG -3′; 805R: 5′- GACTACHVGGGTATCTAATC-3′; tuf: F: 5′- CAGAAGAAAAAGAACGTGG-3′; R: 5′- GTCCTCAACWGGCATCA-3′) with preceding heterogeneity spacers [23 (link),24 (link)]. Amplicon libraries were constructed using nextera indexing primers (Illumina Inc., San Diego, CA, USA) (PCR program used: 95 °C for 3 min; 20 cycles of 98 °C for 20 s, 55 °C for 15 s, and 72 °C for 45 s; 72 °C for 5 min) and sequenced on a MiSeq instrument using a 600 cycle V3 kit (Illumina Inc., San Diego, CA, USA).
3
ATAC-seq on Ezh2 knockout cells
4
ATAC-seq Protocol for Epigenomic Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ATAC-seq13 (link) was performed by resuspending 1,000 to 20,000 FACS sorted cells in 50 μl nuclei lysis buffer (10 mM Tris pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% IGEPAL CA-630) and centrifuged at 500g for 30 min at 4°C. Next, the supernatant was removed and cells resuspended in 25 μl tagmentation mix (300 mM NaCl, 100 mM EDTA, 0.6% SDS, 1.6 μg Proteinase-K) and placed in a thermocycler at 37°C for 1 h. Cells were lysed and high molecular weight DNA removed using a 0.6× SPRI-bead negative selection and low molecular weight DNA purified by 1.2× SPRI-bead positive selection. The resulting tagmented DNA was PCR amplified and indexed using Nextera Indexing primers (Illumina, Inc) and 2× HiFi Hotstart Ready Mix (Roche, Inc). Following PCR, high molecular weight DNA was removed using a 0.3× SPRI-bead negative selection and low molecular weight DNA purified by 1× SPRI-bead positive selection. Final libraries were checked for ATAC-seq specific patterning on a Bioanlyzer and quantitated by qPCR prior to pooling at equimolar ratios and sequenced on a HiSeq2500 using 50bp PE chemistry.
5
ATAC-Seq for Assaying Chromatin Accessibility
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ATAC-seq17 (link) was performed using 20,000 FACS isolated cells that were resuspended in nuclei lysis buffer (10 mM Tris pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% IGEPAL CA-630) and centrifuged at 500×g for 30 min. Next, nuclei were transposed in 25 μl tagmentation reaction mix (2 × Tagmentation buffer and 2.5 μl Tagmentation Enzyme from the Illumina Nextera DNA Library Prep Kit) at 37 °C for 1 hr, diluted 2 × in Lysis Buffer (300 mM NaCl, 100 mM EDTA, 0.6% SDS, 1.6 μg Proteinase-K), and incubated for 30 min at 40 °C. Low-molecular weight transposed DNA was isolated by size selection using SPRI-beads and PCR amplified using 2 × KAPA HiFi HotStart Ready mix and Nextera Indexing Primers (Illumina, Inc). A second size-selection was performed post-PCR to enrich for low molecular weight DNA. Samples were quality checked for ATAC-seq specific patterning on a bioanalyzer and were pooled at an equimolar ratio and sequenced on a HiSeq2500 using 50 bp single-end chemistry.
6
ATAC-seq Library Preparation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ATAC-seq was performed as previously described (PMID: 27249108). Briefly, FACS isolated cells were resuspended in 25 ml tagmentation reaction buffer (12.5 ml Tagment DNA Buffer; Illumina, Inc, 2.5 ml Tn5, 0.02% Digitonin, 0.1% Tween-20) and transposed at 37°C for 1 h. Transposed nuclei were lysed by addition of 2× in lysis buffer (300 mM NaCl, 100 mM EDTA, 0.6% SDS, and 1.6 mg Proteinase-K), and incubated for 30 min at 40°C. Size selection using SPRI-beads isolated low molecular weight DNA which was then PCR amplified using 2 × HiFi HotStart Ready mix (Roche Diagnostics) and Nextera Indexing Primers (Illumina, Inc). A second size-selection was performed post-PCR to enrich for low molecular weight DNA. Samples were quality checked for ATAC-seq specific patterning on a bioanalyzer and were pooled at an equimolar ratio and sequenced on a NextSeq500 using 75 bp paired-end chemistry at the University of Alabama, Birmingham Helfin Genomics Core.
7
ATAC-seq Profiling of Chromatin Accessibility
8
16S rRNA Gene Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR for 16S rRNA gene sequencing targeted the first 330 bases of the V1-V2 region, using the following PCR primers 27 F1 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAGAGTTTGATCMTGGCTCAG and 336R1 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACTGCTGCSYCCCGTAGGAGTCT.
PCR cycling conditions consisted of an initial denaturation at 94 °C for 2 min, followed by 25 cycles of 94 °C for 40 s, 56 °C for 15 s, 68 °C for 40 s, and a final extension at 68 °C for 5 min. The amplicons were indexed using Illumina Nextera indexing primers following the manufacturer’s instructions (Illumina, San Diego, CA, USA).
PCR cycling conditions consisted of an initial denaturation at 94 °C for 2 min, followed by 25 cycles of 94 °C for 40 s, 56 °C for 15 s, 68 °C for 40 s, and a final extension at 68 °C for 5 min. The amplicons were indexed using Illumina Nextera indexing primers following the manufacturer’s instructions (Illumina, San Diego, CA, USA).
9
ATAC-seq Protocol for Epigenomic Profiling
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!