ARPE-19 RNA was isolated using Qiagen RNEasy Plus kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Briefly, cells were lysed using β-mercaptoethanol and Qiagen RLT Plus buffer and then centrifuged through a Qiashredder column to remove large debris and contaminants. Genomic DNA was removed using an eliminator column. Following this, ethanol was used to provide binding conditions for RNA to the RNeasy spin column, while other non-RNA contaminants were then washed away. The RNA was then eluted through the column and quantified using a NanoDrop™ spectrophotometer and associated software. Next, the RNA was normalized to a uniform concentration. Samples were reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biostystems). PCR was performed using SYBR Green PCR Master (Applied Biosystems) mix and PikoReal real time PCR system. The fold change relative gene expression compared to that of the control TCPS was determined using the delta-delta Ct method determining fold change compared to the housekeeping gene, GAPDH (N=21 total; n=3 for each scaffold). The expression was then normalized to day 1 expression to determine how the expression changed through the days of culture. Primer sequences are outlined in the Table .
Pikoreal real time pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, China, Japan, Finland, Estonia, France
The PikoReal Real-Time PCR System is a compact, high-performance real-time PCR instrument designed for a wide range of applications. It features a Peltier-based thermal block, a high-resolution optical system, and intuitive software for data analysis and result interpretation.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (29 mentions)
Trizol, by Thermo Fisher Scientific (9 mentions)
Rneasy mini kit, by Qiagen (8 mentions)
Primescript rt reagent kit, by Takara Bio (8 mentions)
Sybr premix ex taq 2, by Takara Bio (8 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (8 mentions)
Luminaris color higreen qpcr master mix, by Thermo Fisher Scientific (6 mentions)
Sypro orange protein gel stain, by Thermo Fisher Scientific (6 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (5 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (5 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (5 mentions)
Kapa sybr fast qpcr kit, by Roche (5 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (5 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (5 mentions)
Thunderbird sybr qpcr mix, by Toyobo (4 mentions)
Dnase, by Promega (4 mentions)
Sybr premix ex taq 2, by Thermo Fisher Scientific (4 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (4 mentions)
Dynamo colorflash sybr green qpcr kit, by Thermo Fisher Scientific (4 mentions)
Revertra ace qpcr rt master mix, by Toyobo (4 mentions)
169 protocols using pikoreal real time pcr system
1
ARPE-19 Cell RNA Isolation and Expression Analysis
2
Quantitative Real-Time PCR Analysis of ARPE-19 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ARPE‐19 RNA was isolated using Qiagen RNEasy Plus kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. Briefly, cells were lysed using β‐mercaptoethanol and Qiagen RLT Plus buffer and then centrifuged through a Qiashredder column to remove large debris and contaminants. Genomic DNA was removed using an eliminator column. Following this, ethanol was used to provide binding conditions for RNA to the RNeasy spin column, while other non‐RNA contaminants were then washed away. The RNA was then eluted through the column and quantified using a NanoDrop™ spectrophotometer and associated software. Next, the RNA was normalized to a uniform concentration. Samples were reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biostystems). PCR was performed using SYBR Green PCR Master (Applied Biosystems) mix and PikoReal real time PCR system. The primer sequences used are listed in Table 2 . The fold change relative gene expression compared to that of the control TCPS was determined using the delta‐delta Ct method after normalizing to the housekeeping gene, GAPDH (n = 5 for each condition).
3
Quantification of Fibrotic Markers by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells of each group using TRIzol® reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The RNA quality and quantity were determined with a Nanodrop spectrophotometer (Nanodrop 2000c; Thermo Fisher Scientific, Inc., Wilmington, DE, USA), and the RNA purity was determined by gel electrophoresis. RNA (2 µg) was reverse-transcribed by Transcriptor First Strand cDNA Synthesis kit (Roche Diagnostics, Bazel, Switzerland). RT-qPCR was performed to determine the original number of specific transcripts associated with fibrotic markers using FastStart Universal SYBR Green Master (Roche Diagnostics). The miRNAs expression was normalized to U6 as a housekeeping gene and the mRNA expression was normalized against β-actin. RT-qPCR was conducted using the PikoReal™ Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientifc, Inc.) with the following reaction conditions: Initial denaturation at 95°C for 10 min; 40 cycles of denaturation at 95°C for 15 sec, annealing at 58°C for 60 sec and extension at 65°C for 30 sec; followed by melting curve analysis. Each test was performed in triplicate and the 2−ΔΔCq method (22 (link)) was used to calculate the expression of miRNAs and mRNA in LX-2 cells. The primers sequences used in the present study are listed in Table I .
4
Quantifying Aspergillus flavus Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Aspergillus flavus mycelia from the WT, ΔnmrA, and ΔnmrA::nmrA strains were harvested after 48 h of growth. RNA was extracted with TRIzol reagent (Biomarker Technologies, Beijing, China), and then a Nano Drop 2000 and Agilent 2100 were used to evaluate the quality of RNA after total RNA extraction and DNase I treatment. TransScript® All-in-One First-Strand cDNA Synthesis SuperMix was used to synthesize cDNA, and RT-qPCR was performed on a PikoRealTM Real-Time PCR System (Thermo Scientific Inc.) with PikoRealTM 2.2 software using TransStart Top Green qPCR SuperMix (TransGen Biotech, Beijing, China). The RT-qPCR conditions were as follows: 95°C for 7 min and 40 cycles of 95°C for 5 s and 60°C for 30 s. The A. flavus actin gene was used as an reference gene to normalize the expression data. The relative expression of genes was calculated using the 2-ΔΔCt method, and standard deviation was calculated from three biological replicates (Livak and Schmittgen, 2001 (link)). The gene-specific primers are shown in Supplementarey Table S3 .
5
Quantitative PCR Analysis of NBR1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR was performed using cDNA isolated from the material used for transcriptomic analysis and the following pair of oligonucleotides (5′-TCAGGTGTACTCGCCCTAAA-3′) and (5′- GCGAACCACTGTTCCTCATT-3′) as the forward and reverse primers, respectively, in a PikoRealTM Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) with Luminaris Color HiGreen qPCR Master Mix (Thermo Fisher Scientific). The primers are complementary to the coding region of NBR1. Actin 2 (At3g18780) was selected as a constitutively expressed gene to normalize the quantity of total RNA present in each sample. Relative gene expression levels were calculated using the delta-delta Ct method [25 (link)]. The qPCR was carried in 3 biological replicates (each in 3 technical replicates to assess operator variance).
6
Quantitative PCR of Lak Phage MCP Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
This protocol has been validated for use with the QuantiNova SYBR Green PCR kit (Qiagen, Hilden, Germany), and PikoRealTM real-time PCR system (Thermo Fisher Scientific, MA, USA) (Crisci et al., 2021 (link)). However, the following procedure can be adapted for any SYBR green-based qPCR kit and compatible instrument. As Lak phage genomes are generally AT-rich, the MCP gene was selected due to its conservation and higher GC content (∼41%) than other genes, which provides better thermal stability in qPCR reactions.e.g. (−1+10−1/slope) × 100
7
Extracellular Matrix Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 19 patients (SR n = 11, AF n = 8) were evaluated for the gene expression of several extracellular matrix proteins: collagen I (COL1A1) and III (COL3A1), Tissue Inhibitor of Metalloproteinase (TIMP) 1, TIMP4, Matrix Metalloproteinase (MMP) 2 and MMP9. RNA extraction was performed using a TRIzol protocol following the manufacturer’s instructions and RNA concentration and integrity were assessed both in the Nanodrop from Thermo Fisher Scientific® (Waltham, Massachusetts, United States) and by electrophoresis. cDNA (100 ng/µL) was synthesized using the SensiFASTTM cDNA Synthesis Kit from Meridian Bioscience Inc® (Cincinnati, Ohio, United States), with reactions conducted in a T100 thermal cycler from Bio-Rad® (Hercules, California, United States). RT-qPCR reactions were performed using the PikoRealTM Real-Time PCR System from Thermo Fisher Scientific® (Waltham, Massachusetts, United States), using previously described protocols [19 (link)]. Before gene expression quantification using the 2−ΔCT method, PCR efficiency of each gene, including the internal control gene (18s RNA) was determined and it was assured they were identical.
Target gene expression was normalized to the 18S gene. Initial mRNA expression data were logarithm transformed using the 2−ΔCT method [20 (link)].
Target gene expression was normalized to the 18S gene. Initial mRNA expression data were logarithm transformed using the 2−ΔCT method [20 (link)].
8
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using RNAiso plus (Takara Bio Inc., Shiga, Japan) and quantified with a BioSpec-nano spectrophotometer (Shimadzu Inc., Kyoto, Japan). Subsequently, 1 μg RNA was converted to cDNA using the FastGene Scriptase II cDNA Kit (NIPPON Genetics, Düren, Germany). To carry out Quantitative Real-Time PCR analyses, the 5x HOT FIREPol® EvaGreen® qPCR Supermix (Solis BioDyne, Tartu, Estonia) and PikoRealTM Real-Time PCR System (Thermo Fisher Scientific Inc., Waltham, MA, USA) were used. Specific primers for the human genes studied were as described before [42 (link)]. The HMBS gene was used as a normalizer.
9
Validating Differential Gene Expression in MDS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time quantitative PCR (qRT-PCR) was used to validate significantly upregulated or downregulated genes (fold changes of >2 or <−2, respectively) in a separate cohort of 24 MDS patients and 20 healthy controls. cDNA was synthesized using the Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA). PCR amplification was performed using the Hot Firepol EvaGreen Taq polymerase (Solis Biodyne, Tartu, Estonia) on a PikoRealTM Real-Time PCR System (Thermo Fisher Scientific, Applied Biosystems, Waltham, MA, USA). Gene expression levels were normalized against those of the housekeeping gene HPRT1 using the 2−∆∆CT method. All samples were run in duplicate. Supplementary Table S3 summarizes all primer sequences used in the context of the qRT-PCR experiments, while Supplementary Table S4 shows the standard deviation values between sample replicates.
10
Quantitative RT-PCR Analysis of FMR1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative RT-PCR (qRT-PCR) was performed on the synthesized cDNA templates to detect relative mRNA expression levels of FMR1 gene in the three study groups by 5x HOT FIREPol EvaGreen qPCR Mix Plus (no ROX) (Solis Biodyne). The housekeeping gene ATP5b was used as a reference gene to normalize the target gene expression. The primers used are as follows: for FMR1 F-GCAGATTCCATTTCATGATGTCA, R–ACCACCAACAGCAAGGCTCT, product length 122bp [15 (link)] and for ATP5b F-TCACCCAGGCTGGTTCAGA and R- AGTGGCCAGGGTAGGCTGAT, product length 80bp [23 (link)]. The reaction was performed in a 10 μl volume containing: 1x qPCR Mix, 0.3 μM of each primer set, DNase-RNaseFree water and 1μl of 5-fold diluted cDNA on PikoRealTM Real-Time PCR System (Thermo Fisher Scientific Inc.). The cycling conditions included 15 min at 95 °C, followed by 40 cycles of 15 s at 95 °C, 30 s at 60 °C, 45 s at 72 °C, and final elongation for 5 min at 72 °C. No template control (NTC) was added in each experiment. Data were analyzed using PikoReal Software version 2.1 (Thermo Fisher Scientific Baltics UAB). Standard curves were generated to assess the efficiency of the amplification.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!