Dna purification kit

The DNA sequence (length ranges from ~300 to 700 bp) containing the test SNP was amplified using primers (Supplementary Table 10) linked with homologous arms (which were identical with the sequence (located at the multiple clone sites) of pGL3-promoter vectors) (Supplementary Fig. 12) and PCR products were purified with DNA Purification Kit (DP209, TIANGEN). We digested pGL3-Promoter vector (E1761, Promega) and pGL4.11 vector (E6661, Promega) with KpnI (FD0524, FastDigest) and XhoI (FD0694, FastDigest), and the digestion products were purified with DNA Purification Kit. Then the purified DNA fragments containing the test SNP were inserted into the pGL3-Promoter vector using the Trelief^TM SoSoo Cloning Kit (TSV-S1, TSINGKE). As SNP rs2270363 is located in promoter region, we inserted the DNA fragments containing rs2270363 into the pGL4.11, which is a basic vector with no promoter. The ligated vectors were then used to transform DH5α competent cells (Takara). LB plates (with the selectable marker, ampicillin) were used to select the transformed cells and recombinant plasmids were extracted from the transformed cells grown from single colony. PCR-mediated point mutation technique was used to generate the DNA fragments containing the alternative allele of this test SNP. All sequences of the inserted DNA fragments were verified using Sanger sequencing.

ChIP assay was performed as previously described [40 (link)]. Briefly, approximately 1 × 10⁷ cells were fixed with 1 % formaldehyde and quenched by glycine. The cells were washed three times with PBS and then harvested in ChIP lysis buffer (50 mM Tris-HCl, pH 7.6, 1 mM CaCl₂, 0.2 % Triton X-100). DNA was digested to 150–300 bp by MNase (Sigma) before extensive centrifugation. Four volumes of ChIP dilution buffer (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 2 mM EDTA, 1 % Triton X-100, 0.1 % SDS) was added to the supernatant. The resulted lysate was then incubated with protein G beads and antibodies at 4 °C over night. The beads were washed five times and DNA was eluted by Chip elution buffer (0.1 M NaHCO₃, 1 % SDS, 20 μg/ml proteinase K). The elution was incubated at 65 °C over night and DNA was extracted with DNA purification kit (TIANGEN). The purified DNA was assayed by quantitative PCR with Biorad MyIQ. Assays were repeated at least three times. Data shown were average values ± SD of representative experiments. The sequences of primers are in Additional file 2: Table S16.

Etha promoter DNA with/without biotin-labeling for the DNA-binding activity assays were synthesized by annealing the complementary single-stranded oligo synthesized by Sangon Co., Ltd. (Sangon, Shanghai, China), and then purified by DNA purification Kit (Tiangen, Beijing, China). Ethr (0.43 μM) was incubated with 0, 2, 5, 10, 25, 50, 100, and 200 μM c-di-GMP and 200 μM c-di-AMP and 200 μM cGMP in a total volume of 13 μL PBS buffer at RT for 1 h. Then biotinylated etha promoter was added and co-incubated at RT for 20 min in a total volume of 20 μL EMSA buffer. The reaction mixtures were then subjected to 8% native PAGE, and transferred to a nylon membrane. The membrane was exposed to 254 nm UV light with 120,000 μJ from HL-2000 Hybridization Incubator (UVP, California, US) for 2 min. EMSA assay was completed using EMSA kit (Thermo) according the manufacturer’s instruction. Images were acquired using a Typhoon Scanner (GE Healthcare).

The original sequences of sHSP genes were obtained from H. cunea transcriptome data (unpublished by our laboratory). Primers for PCR amplification of sHSP Open Reading Frame (ORF) were designed using an online tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 25 March 2022)) and are listed in Table 1. The PCR program consisted of 30 cycles, 98 °C for 10 s, 55 °C for 30 s, and 72 °C for 1 min. PCR products were detected on 1% agarose gel and extracted with a DNA purification kit (TIANGEN, Beijing, China). The PCR products were cloned into a T/A vector and transformed into DH5α competent cells (Vazyme, Nanjing, China). After 14 h, positive clones were selected and sequenced by Sangon, Shanghai, China.

Multilocus sequence typing (MLST) was performed following a previous description (Curran et al., 2004 (link)) with minor modifications to confirm the allelic profiles of the two isolates. Briefly, genomic DNA was isolated from overnight bacterial culture with a DNA purification kit (Tiangen Biotech, Beijing, China) for use as PCR template. The internal fragments of seven housekeeping genes (acsA, aroE, guaA, mutL, nuoD, ppsA and trpE) were amplified by PCR and sequenced using primers described previously (Supplementary Table S1) (Curran et al., 2004 (link)). Gene sequences were then submitted to the P. aeruginosa MLST database¹ for assignment of allelic numbers. A sequence type (ST) was assigned to each isolate by combining the seven allelic numbers.

DNA was extracted from peripheral blood leukocytes collected from the study participants using a DNA Purification Kit (Tiangen Biotech) according to the manufacturer’s instructions [28 (link)]. Genotyping was done with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOFMS) using a MassARRAY system (Sequenom, San Diego, CA, USA). The primers used for nucleotide extension reaction were AGAAAGATGTTATCATCGTCACTG (forward) and GATGCCTTCAGATGCGAGTA (reverse). About 10% of the selected samples were randomly chosen for genotyping twice to ensure the genotyping accuracy. The results were 100% concordant.

In order to further confirm the role of mutations in cls and gdpD genes, site-directed mutagenesis was performed using overlap extension PCR (SOE-PCR; Ho et al., 1989 (link)). The cls gene was divided into four fragments at three mutated sites, and gdpD gene was divided into two fragments at one mutated site. The primers used are shown in Supplementary Table 1.
The SOE-PCR process consisted of two consecutive reactions. First-round PCR: Genomic DNA of E. faecium EF332 was used as a template to obtain the corresponding gene fragments. PCR products obtained were purified using the DNA purification kit (TIANGEN, Beijing, China). Second-round PCR: The purified PCR products obtained from the previous step were used as templates, and corresponding primers were added to the reaction system for amplification.
These point mutations led to the amino acid substitutions T269I, V203I, T298S in Cls, and S201P in GdpD. Plasmids carrying these mutated gene fragments were transformed to obtain EFDO-cls and EFDO-gdpD strains by the method described above.