Log In Sign up
The largest database of trusted experimental protocols

Hiscript 3 first strand cdna synthesis kit

Manufactured by Vazyme
Visit Supplier
Sourced in China

The HiScript III first Strand cDNA Synthesis Kit is a laboratory reagent used for the conversion of RNA into complementary DNA (cDNA). The kit contains the necessary components to perform this reverse transcription process, including a reverse transcriptase enzyme and buffers.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (10 mentions) Chamq universal sybr qpcr master mix, by Vazyme (4 mentions) Fastpure cell tissue total rna isolation kit, by Vazyme (4 mentions) Chamq sybr qpcr master mix, by Vazyme (4 mentions) Rnaiso plus reagent, by Takara Bio (3 mentions) Trizol reagent, by Takara Bio (3 mentions) Chamq universal sybr qpcr master mix kit, by Vazyme (3 mentions) Taq pro universal sybr qpcr master mix, by Vazyme (2 mentions) Abi 7500 real time pcr system, by Thermo Fisher Scientific (2 mentions) Sybr qpcr master mix, by Vazyme (2 mentions) Aceq universal sybr qpcr master mix, by Vazyme (2 mentions) Quant studio tmdx, by Thermo Fisher Scientific (2 mentions) Masterpure yeast rna purification kit, by Illumina (1 mentions) Lightcycler 480, by Roche (1 mentions) Mirna universal sybr qpcr master mix, by Vazyme (1 mentions) Mirna first strand cdna synthesis kit, by Vazyme (1 mentions) Cfx connect optics module, by Bio-Rad (1 mentions) Bulge loop mirna qrt pcr starter kit, by RiboBio (1 mentions) Abi7500 quantitative pcr system, by Thermo Fisher Scientific (1 mentions) Facsaria 3, by BD (1 mentions)

Spelling variants of this product

CDNA synthesis kit (139 citations) HiScript First Strand cDNA Synthesis Kit (32 citations) HiScript III first-strand cDNA synthesis kit (+gDNA wiper) (11 citations) HiScript III (4 citations) HiScript III Kit (3 citations)

39 protocols using hiscript 3 first strand cdna synthesis kit

1

Quantitative RT-PCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was purified using a TRIzol reagent (1–5 × 106 cells/1 ml TRIzol) according to the manufacturer's procedure (Invitrogen). One microgram of total RNA was reverse transcribed into first strand cDNA with the HiScriptIII first Strand cDNA Synthesis Kit (Vazyme). Then, real‐time quantitative reverse transcription PCR (RT–qPCR) procedures were conducted in triplicate using Taq Pro Universal SYBR qPCR Master Mix (Vazyme). GAPDH was used as a loading control for each gene, and comparative CT analysis was used to quantify the gene expression. At least three experiments were repeated. The primers used in this study were as follows:
hITG‐E6‐F: CCTAATGACGGGCAGTGTCA
hITG‐E9‐R: TCACGCACTTCCAGCTCTAC
hITG‐E5‐F: AGCAGAGTGTGTCACGGAAC
hITG‐E7‐R: TCAGTCATCAGCCCCAAAGAG
Li Q., Chen G., Jiang H., Dai H., Li D., Zhu K., Zhang K., Shen H., Xu H, & Li S. (2023). ITGB3 promotes cisplatin resistance in osteosarcoma tumors. Cancer Medicine, 12(7), 8452-8463.
+ Open protocol
+ Expand
2

Laurdan Fluorescence and RNA-seq Analysis of Yeast

Check if the same lab product or an alternative is used in the 5 most similar protocols
Yeast cells logarithmically growing in YPL or 12 h after the switch to SL were collected and spheroplasted with 1 mg/mL zymolyase in 1 M sorbitol. The spheroplasts were incubated with 1 mM Laurdan at 30 C for 30 min. Samples were excited at 360 nm using a SynergyNEO2 Multiscan Spectrum (Biotek), and fluorescence intensities were measured at 440 nm and 490 nm. The Laurdan GP value was calculated: GP = (I 440 -I 490 )/(I 440 -I 490 ). The background of the laurdan-containing buffer was subtracted from emission values (Kaiser et al., 2011) .
RNA-seq analysis RNA isolation of yeast cells under different growth conditions was carried out following the manufacturer's manual using the MasterPure yeast RNA purification kit (Epicenter). RNA concentration was determined by absorbance at 260 nm. 1 mg RNA was reverse transcribed to cDNA using HiScript III first Strand cDNA Synthesis Kit (Vazyme). RNA samples were prepared in two biological replicates as described above. Library construction and sequencing were performed by Genewiz. Detailed procedures can be found from the following website: https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_ Specifications_US.pdf.
Fang W., Zhu Y., Yang S., Tong X, & Ye C. (2022). Reciprocal regulation of phosphatidylcholine synthesis and H3K36 methylation programs metabolic adaptation. Cell reports, 39(2).
+ Open protocol
+ Expand
3

RNA Extraction and RT-qPCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using RNAiso Plus reagent (Takara). Reverse transcription was performed using a HiScript III First Strand cDNA Synthesis Kit (Vazyme, China) by following the manufacturer’s protocol. RT-qPCR assay was performed with SYBR green PCR master mix reagent (Vazyme, China) on the LightCycler 480 (Roche). The primer sets were listed in Supplementary Table S2.
Lu Y., Chan Y.T., Tan H.Y., Zhang C., Guo W., Xu Y., Sharma R., Chen Z.S., Zheng Y.C., Wang N, & Feng Y. (2022). Epigenetic regulation of ferroptosis via ETS1/miR-23a-3p/ACSL4 axis mediates sorafenib resistance in human hepatocellular carcinoma. Journal of Experimental & Clinical Cancer Research : CR, 41, 3.
+ Open protocol
+ Expand
4

Quantitative Analysis of miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
One microgram of RNA was reverse transcribed to cDNA using HiScript III First Strand cDNA Synthesis kit (+gDNA wiper; Vazyme). qPCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme). All samples were performed in triplicate. The results were normalized to β-actin mRNA. The expression levels of specific miRNAs were analyzed by quantitative PCR with specific stem-loop RT primer. The results were normalized to U6 small nuclear RNA. The primer sequences used in RT-qPCR are listed in Supplementary Table 4.
Wang Q., Wang J., Xu Y., Li Z., Wang B, & Li Y. (2022). The Interaction of Influenza A NS1 and Cellular TRBP Protein Modulates the Function of RNA Interference Machinery. Frontiers in Microbiology, 13, 859420.
+ Open protocol
+ Expand
5

qPCR for DEG and miRNA Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols
For DEG validation, total RNA from each sample was used to prepare cDNA using a HiScript III first strand cDNA synthesis kit (Vazyme, Nanjing, China). Then, qPCR was performed using the ChamQ universal SYBR qPCR master mix (Vazyme) on an ABI 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The miRNA first strand cDNA synthesis kit (Vazyme) and the miRNA universal SYBR qPCR master mix (Vazyme) were used for miRNA validation per manufacturer’s protocols. The relative expression levels of genes or miRNAs (normalized to goat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or U6 snRNA, respectively) were calculated by the 2−ΔΔCt method. All experiments were performed in triplicate.
Pang F., Wang X., Chen Z., Zhang Z., Zhang M., Wang C., Yang X., An Q., Du L, & Wang F. (2020). Integrated Analysis of Differentially Expressed miRNAs and mRNAs in Goat Skin Fibroblast Cells in Response to Orf Virus Infection Reveals That cfa-let-7a Regulates Thrombospondin 1 Expression. Viruses, 12(1), 118.
+ Open protocol
+ Expand
6

Quantifying mRNA and miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
To quantify mRNA from drug-treated or DMSO-treated cells, total RNA was extracted using the FastPure Cell/Tissue Total RNA Isolation Kit (RC112-01, Vazyme) as instructed. Briefly, 1 μg of total RNA was reverse-transcribed as complementary DNA using HiScript III first Strand cDNA Synthesis kit (R312-01, Vazyme). qPCR procedure was carried out using ChamQ Universal SYBR qPCR master mix (Q711-02, Vazyme) on a Bio-Rad Connect real-time PCR instrument (CFX Connect TM Optics Module). β-actin was used as a reference gene. Gene-specific primers were as listed in the Table S4. For miRNA detection, total RNA was reverse-transcribed as cDNA and subsequent qPCR analysis was performed using the Bulge-Loop miRNA qRT-PCR Starter Kit (C10211-2, Ribobio). The miRNA qPCR primer sets were purchased from RiboBio (Table S6). U6 snRNA was used as the endogenous control to normalize miRNA expression. The 2-ΔΔCt method was used to calculate fold changes in gene expression.
Li J., Li S., Yu S., Yang J., Ke J., Li H., Chen H., Lu M., Sy M.S., Gao Z, & Li C. (2023). Persistent ER stress causes GPI anchor deficit to convert a GPI-anchored prion protein into pro-PrP via the ATF6–miR449c-5p–PIGV axis. The Journal of Biological Chemistry, 299(8), 104982.
+ Open protocol
+ Expand
7

Quantitative PCR Analysis of RNA Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
After the total RNA was extracted from BV2 cells, primary microglial cells or tissues using RNAiso Plus reagent (Takara, Tokyo, Japan), the total RNA (500 ng) was reverse transcribed into cDNA using HiScript III first Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). Real-Time Quantitative PCR was carried out using Taq Pro universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) and ABI-7500 quantitative PCR system (Applied Biosystems, Warrington, United Kingdom). The sequence of PCR primers was shown in Table 2 (Gu et al., 2018 (link)).
Fang J., She J., Lin F., Wu J.C., Han R., Sheng R., Wang G, & Qin Z.H. (2022). RRx-001 Exerts Neuroprotection Against LPS-Induced Microglia Activation and Neuroinflammation Through Disturbing the TLR4 Pathway. Frontiers in Pharmacology, 13, 889383.
+ Open protocol
+ Expand
8

FACS-based Transcriptomic Profiling of Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Tg(kdrl:EGFP) Embryos were collected and manually dechorionated at 24 hpf, and followed by washing with PBC for three times and digested with 0.25% trypsin at 37°C. The digested cells were collected by centrifugation and allowed to pass through a 40 mm FACS tube (BD Falcon, 352340). The EGFP positive cells were sorted by fluorescence-activated cell sorting on FACS Aria3 (BD Biosciences). Afterwards, total RNA was extracted by TRIzolTM reagent (Thermo Fisher Scientific, 15596026) and reversely transcribed by using the HiScript III first Strand cDNA Synthesis Kit (Vazyme, R312-01). Apart from ifi30, two vascular markers (kdrl and fli1a), one arterial marker (dll4), and the housekeeping gene (ef1a), were also examined by RT-PCR. The primers for RT-PCR were listed in the Supplementary Table.
Wang X., Ge X., Qin Y., Liu D, & Chen C. (2022). Ifi30 Is Required for Sprouting Angiogenesis During Caudal Vein Plexus Formation in Zebrafish. Frontiers in Physiology, 13, 919579.
+ Open protocol
+ Expand
9

Quantitative Gene Expression Analysis in Tomato

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from frozen tomato samples (approximately 100 mg) using Trizol reagent (Invitrogen, Thermo Fisher, Waltham, MA, USA). After the measurement of A260/280 and A260/230 to check the purity and integrity, miRNA and RNA were converted to cDNA with a miRNA first-strand cDNA synthesis kit (by stem-loop) (Vazyme, Nanjing, China) and HiScript III first-strand cDNA synthesis kit (Vazyme, Nanjing, China), respectively. Quantitative real-time PCR was operated on a quantitative PCR system (qTower3, Analytik jena, Jena, Germany) using chamQ SYBR qPCR master mix (Vazyme, Nanjing, China) following the instruction. The relative expression rate was calculated using the ΔΔCt method. U6 was for miR398, while Actin was used as the internal reference for CSD1, CSD2, IRT1, IRT2, NRAMP2, and HMA3. The sequence of primers used in this study were listed in supplementary Table S1.
Yan G., Hua Y., Jin H., Huang Q., Zhou G., Xu Y., He Y, & Zhu Z. (2023). Sly-miR398 Participates in Cadmium Stress Acclimation by Regulating Antioxidant System and Cadmium Transport in Tomato (Solanum lycopersicum). International Journal of Molecular Sciences, 24(3), 1953.
+ Open protocol
+ Expand
10

Molecular Characterization of VvMYB30 in Grapes

Check if the same lab product or an alternative is used in the 5 most similar protocols
The nucleic acid sequence of VvMYB30 was obtained from the Grape Genome database (http://www.grapegenomics.com/pages/PN40024/) (Jaillon et al., 2007) . The location of the VvMYB30 gene on the grape genome was analyzed using the On-Line BLAST tool and Genome Browser tool, which was also from the database. The primers used to amplify the full-length coding sequence and genomic DNA of VvMYB30 were designed using CE Design V1.04 software. DNA from the mature leaves of "Hongbaladuo" was extracted using a Plant Genomic DNA Extraction Kit (Aidlab Biotech, China) and the genomic DNA sequence of VvMYB30 was amplified using PCR. Total RNA extracted from the mature leaves of "Hongbaladuo," "Gros Colman," "Beihong," and "Zhi186" using an RNAprep Pure Plant Kit (TIANGEN, China) was reverse transcribed using a HiScript III First Strand cDNA Synthesis Kit (Vazyme, China). The coding sequences of MYB30 were cloned from these varieties. The PCR products were cloned into the pLB-Simple vector (TIANGEN, China) and sequenced. Multiple sequence alignment of MYB30 coding sequences from the above varieties was conducted using DNAMAN. The protein domains of VvMYB30 were predicted using SMART (http://smart.emblheidelberg.de/). Alignment of VvMYB30 and VvMYB14 amino acid sequences was also conducted using DNAMAN.
Mu H., Li Y., Yuan L., Jiang J., Wei Y., Duan W., Fan P., Li S., Liang Z, & Wang L. (2023). MYB30 and MYB14 form a repressor-activator module with WRKY8 that controls stilbene biosynthesis in grapevine. The Plant cell, 35(1).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!