Real time pcr detection system

Total RNA extraction and quantification were performed according to the RNAsimple Total Kit protocol (Tiangen Biotech, Beijing, China). NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) was used to quantify the RNA samples. Following RNA extraction, RT Master Mix (Takara Bio Inc., Dalian, China) was used to generate cDNA with according to the manufacturer’s protocol.
The primers were as follows: glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used to normalize all samples. The specific sense and antisense primer sequences used are available Table 1. The RT-PCRs by a SYBR green-based PCR method were performed using a real-time PCR detection system (Eppendorf, Hamburg, Germany) with a program of 40 cycles of amplification (95 °C for 5 s, 60 °C for 30 s and 72 °C for 42 s). The relative expression level of each mRNA was calculated using the 2−ΔΔCt method.

RNA extraction was performed according to the RNA Simple Total Kit protocol (Tiangen Biotech, Beijing, China). A NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA) was used to quantify the RNA samples. RT Master Mix (Takara Bio, Inc., Dalian, China) was used for cDNA synthesis. The samples were run on a real-time PCR detection system (Eppendorf, Hamburg, Germany) with a SYBR green-based PCR method for mRNA expression analysis. All reactions were prepared in triplicate. Target gene expression was analysed using the comparative cycle threshold (CT) method [22 (link)].

Total RNA was isolated from the mouse retinas with a Trizol reagent according to the RNAsimple Total Kit instructions (Tiangen Biotech, Beijing, China), which was then reverse transcribed into complementary DNA (cDNA) with a reagent kit (Takara Bio Inc., Dalian, China). The RT‐PCRs, using a SYBR green‐based PCR method, were performed with a real‐time PCR detection system (Eppendorf, Hamburg, Germany). GAPDH was used as an internal reference to normalize the variation amounting to total cDNA. The forward and reverse primers for mouse GAPDH were 5′‐AGGTCGGTGTGAACGGATTTG‐3′ and 5′‐TGTAGACCATGTAGTTGAGGTCA‐3′. The forward and reverse primers for mouse iNOS were 5′‐GTTCTCAGCCCAACAATACAAGA‐3′ and 5′‐GTGGACGGGTCGATGTCAC‐3′. The forward and reverse primers for mouse TGF‐β were 5′‐CTCCCGTGGCTTCTAGTGC‐3′ and 5′‐GCCTTAGTTTGGACAGGATCTG‐3′. The forward and reverse primers for mouse Arg‐1 were 5′‐CTCCAAGCCAAAGTCCTTAGAG‐3′ and 5′‐AGGAGCTGTCATTAGGGACATC‐3′. The forward and reverse primers for mouse Egr1 were 5′‐TCGGCTCCTTTCCTCACTCA‐3′ and 5′‐CTCATAGGGTTGTTCGCTCGG‐3′; the forward and reverse primers for mouse Fos were 5′‐CGGGTTTCAACGCCGACTA‐3′ and 5′‐TTGGCACTAGAGACGGACAGA‐3′. Experiments were performed in three parallel wells and repeated at least twice.