Megaprep kit

Manufactured by Qiagen

Sourced in United States, Germany

The MegaPrep Kit is a laboratory equipment product designed for high-throughput nucleic acid extraction. It is an automated system that can efficiently process multiple samples simultaneously, enabling rapid and reliable purification of DNA or RNA from a variety of sample types.

Automatically generated - may contain errors

Lab products found in correlation

Expifectamine 293 transfection kit, by Thermo Fisher Scientific (3 mentions) Histrap high performance column, by Cytiva (2 mentions) Label it nucleic acid labeling kit with cy5, by Mirus Bio (2 mentions) Block it adenoviral expression system, by Thermo Fisher Scientific (1 mentions) Prfp c rs, by OriGene (1 mentions) Pgfp 5 rs, by OriGene (1 mentions) Stbl3 cells, by Thermo Fisher Scientific (1 mentions) Expicho s cells, by Thermo Fisher Scientific (1 mentions) Poly l lysine (pll), by Merck Group (1 mentions) Yoyo 1 dye, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

EndoFree Plasmid Megaprep Kit Megaprep

12 protocols using megaprep kit

Production and Purification of SARS-CoV-2 RBD

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PDCoV_{IL121_2014} RBD (Genbank KJ481931.1) and SD2018/300 (Genbank KJ481931.1) spanning residues 303–415 were cloned into pcDNA3.1+ plasmid by GenScript with an N-terminal mu-phosphatase signal peptide sequence and C-terminal short linker GSG, AVI tag and 8 x His tag. The DNA constructs were expanded using DH5ɑ cells and purified using Qiagen MegaPrep Kit. Protein was expressed using ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific). Expi293F cells were grown at 37°C with 8% CO₂ to 3E6 cells and transfected with 100 μg of DNA. Cell culture supernatants were harvested four days post-transfection. Protein was purified using HisTrap^Tm High Performance column (Cytiva). Protein was bound to HisTrap resin in 50mM Tris-HCl, 150mM NaCl, 10mM Imidazole at pH 8.0. Unbound proteins were washed in 10 column volumes of 50mM Tris-HCl, 150mM NaCl, 10mM Imidazole at pH 8.0. Eluted with 50mM Tris-HCl, 150mM NaCl, 250 mM Imidazole at pH 8.0. The eluted RBD was concentrated using Amicon Ultra-15 Centrifugal Filter Unit (10 kDa) and buffer exchanged into 50mM Tris, 150mM NaCl pH 8.0 and further purified using size exclusion chromatography Superdex 200 10/300. Endotoxin levels were assessed using Charles River Limulus Amebocyte Lysate (LAL) cartridges. Proteins were snap frozen in liquid nitrogen and stored at −80°C.

Rexhepaj M., Park Y.J., Perruzza L., Asarnow D., Mccallum M., Culap K., Saliba C., Leoni G., Balmelli A., Yoshiyama C.N., Dickinson M.S., Quispe J., Brown J.T., Tortorici M.A., Sprouse K.R., Taylor A.L., Starr T.N., Corti D., Benigni F, & Veesler D. (2024). Broadly neutralizing antibodies against emerging delta-coronaviruses. bioRxiv.

+ Open protocol

+ Expand

Generating Adeno- and Adeno-Associated Viruses for TSC22D4 Alleles

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

AVs expressing the Flag-TSC22D4 alleles (WT, ∆D2, and D2 + TSC) under the control of the cytomegalovirus promoter were cloned using the BLOCK-iT adenoviral expression system (Invitrogen). Viruses were purified by the cesium chloride method and dialyzed against phosphate-buffered saline buffer (PBS) containing 10% glycerol before animal injection, as described (34 (link)).
For generating AAVs with cDNAs of TSC22D4, alleles (WT, ∆D2, and D2 + TSC) were amplified with the following primer pairs followed by Nhe 1 and Xba 1 digestion and subcloning into pdsAAV-LP1 plasmid (35 (link)): TSC22D4-AAV with Nhe I: forward, gatgctagcgtgtgctggaattctg; TSC22D4-AAV with Xba I: reverse, gcatctagactcgagtcagatggaggg. The successful clones sequenced for confirmation with the following primers: pdsAAV-TSC: forward, ctgataggcacctattggtc; reverse, ccacaactagaatgcagtg. Once the sequence is confirmed, the plasmids were purified using QIAGEN Megaprep kit (#12381) according to the manufacturer’s instructions and sent to Vigene Biosciences (Maryland, USA) for AAV generation, purification, and titration.

Demir S., Wolff G., Wieder A., Maida A., Bühler L., Brune M., Hautzinger O., Feuchtinger A., Poth T., Szendroedi J., Herzig S, & Ekim Üstünel B. (2022). TSC22D4 interacts with Akt1 to regulate glucose metabolism. Science Advances, 8(42), eabo5555.

+ Open protocol

+ Expand

Expression and Purification of APN Ectodomain

Check if the same lab product or an alternative is used in the 5 most similar protocols

The APN ectodomain from galline (Genbank ACZ95799.1) and human residues 66–967 was cloned into pcDNA3.1+ plasmid by GenScript with an N-terminal mu-phosphatase signal peptide sequence and C-terminal short linker GGS, thrombin cleavage site, human Fc fragment. The DNA constructs were expanded using DH5ɑ cells and purified using Qiagen MegaPrep Kit. Protein was expressed using ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific). Expi293F cells were grown at 37°C with 8% CO₂ to 3E6 cells and transfected with 100 μg of DNA. Cell culture supernatants were harvested four days post-transfection. Protein was purified using HighTrap Protein A column (Cytiva). Protein was bound to resin in 50mM Tris-HCl, 150mM NaCl pH 8.0. Unbound proteins were washed in 10 column volumes of 50mM Tris-HCl, 150mM NaCl at pH 8.0. Eluted with 0.1 M Citric Acid (pH 3.0) and neutralized with 1 M Tris-HCl (pH 9.0). The eluted APN was buffer exchanged into 50mM Tris, 150mM NaCl pH 8.0 and further purified using size exclusion chromatography Superdex 200 Increase 10/300 GL. Protein was concentrated using the Amicon Ultra-15 Centrifugal Filter Unit (100 kDa). Proteins were snap frozen in liquid nitrogen and stored at −80°C.

+ Open protocol

+ Expand

Plasmid Amplification and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmids carrying reporter genes for either green fluorescent protein (GFP, pGFP-V-RS) or red fluorescent protein (RFP, pRFP-C-RS) were purchased from OriGene (Rockville, MD). Plasmids were amplified in E. coli and isolated using a mega prep kit purchased from Qiagen (cat#: 12181). DNA working solutions used for cartridge preparation were diluted to 1 μg/μL in TE.

Cilz N.I., Porter J.E, & Lei S. (2017). A protocol for preparation and transfection of rat entorhinal cortex organotypic cultures for electrophysiological whole-cell recordings. MethodsX, 4, 360-371.

+ Open protocol

+ Expand

Recombinant SARS-CoV-2 S Glycoprotein Production

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PDCoV_{IL121_2014} S glycoprotein ectodomain (Genbank KJ481931.1) and SD2018/300 (Genbank KJ481931.1) were cloned into pcDNA3.1+ plasmid by GenScript with the host N-terminal signal peptide sequence, C-terminal foldon domain, thrombin cleavage sequence, short linker of GSG, AVI tag and 8 x His tag. The DNA constructs were expanded using DH5ɑ cells and purified using Qiagen MegaPrep Kit. Protein was expressed using ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific). Expi293F cells were grown at 37°C with 8% CO₂ to 3E6 cells and transfected with 100μg of DNA. Cell culture supernatants were harvested four days post-transfection. Protein was purified using HisTrap^Tm High Performance column (Cytiva). Protein was bound to HisTrap resin in 50mM Tris-HCl, 150mM NaCl, 10mM Imidazole at pH 8.0. Unbound proteins were washed in 10 column volumes of 50mM Tris-HCl, 150mM NaCl, 10mM Imidazole at pH 8.0. Eluted with 50mM Tris, 150mM NaCl, 250 mM Imidazole at pH 8.0. The eluted S protein was concentrated using Amicon Ultra-15 Centrifugal Filter Unit (100kDa) and buffer exchanged into 50mM Tris, 150mM NaCl pH 8.0. Endotoxin levels were assessed using Charles River Limulus Amebocyte Lysate (LAL) cartridges. Proteins were snap frozen in liquid nitrogen and stored at −80°C.

+ Open protocol

+ Expand

Adeno-Associated Virus-Mediated Expression of Mutant Erythropoietin in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human Epo cDNA was obtained from Origene (Rockville, MD) and cloned into pBSK (Agilent, Santa Clara, CA). Site-directed mutagenesis was performed to convert two nucleotides, resulting in the amino acid change of R76E (Agilent, Santa Clara, CA). The EpoR76E was subcloned into pAAV2, amplified in Stbl 3 cells (Life Technologies, Carlsbad, CA) and purified using an endotoxin free Mega prep kit (Qiagen, Valencia, CA). Both rAAV2/8.CMV.eGFP and rAAV2/8.CMV.EpoR76E were produced by the University of Pennsylvania vector core and quantified by RT-PCR using the following primers: BGH-PolyA forward TCTAGTTGCCAGCCATCTGTTGT, and BGH-PolyA reverse TGGGAGTGGCACCTTCCA. Mice were injected in the quadriceps with 1x10⁹ genome copies (gc) rAAV2/8.CMV.eGFP or rAAV2/8.CMV.EpoR76E at postnatal day 10 using a beveled Hamilton Syringe. Mice were assessed at 7 and 12 months of age and then collected for histological analysis.

Rex T.S., Kasmala L., Bond W.S., de Lucas Cerrillo A.M., Wynn K, & Lewin A.S. (2016). Erythropoietin Slows Photoreceptor Cell Death in a Mouse Model of Autosomal Dominant Retinitis Pigmentosa. PLoS ONE, 11(6), e0157411.

+ Open protocol

+ Expand

Constructing Mutant HBV DNA Vaccines

Check if the same lab product or an alternative is used in the 5 most similar protocols

To construct MHBs mutant-encoding DNA vaccines from the HBV strain (adr serotype, C genotype) (GenBank: AF052576.1), an existing DNA vaccine, pSW3891/MHBs/adr, was used. The mutated amino acid residues in the pre-S2 domain of MHBs are underlined in bold (Table 1). Four pairs of complementary primers were designed (Table 2). Site-directed mutagenesis was conducted according to the manufacturer's instructions (Stratagene, La Jolla, CA). Four mutated MHBs-encoding DNA vaccines were produced; the N-linked glycosylation site (Asn residue at position 4) was either replaced with Gln (MHBs-dN4) or relocated to position 5 (MHBs-N4-5), position 6 (MHBs-N4-6), or position 7 (MHBs-N4-7). The resulting vaccine plasmid was verified by digestion with restriction enzyme and gene sequencing (Shanghai Invitrogen Biotechnology Co., China). Wildtype MHBs and mutated MHBs-encoding DNA vaccines were produced and purified using a Qiagen Mega prep kit (Hilden, Germany) for in vitro and in vivo studies.

Liu H., Wang S., Jia Y., Li J., Huang Z., Lu S, & Xing Y. (2015). N-Linked Glycosylation at an Appropriate Position in the Pre-S2 Domain Is Critical for Cellular and Humoral Immunity against Middle HBV Surface Antigen. The Tohoku journal of experimental medicine, 236(2).

+ Open protocol

+ Expand

Exogenous MET expression in ExpiCHO-S cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

MET antigens (full length and MET ECD) were cloned in the CMV:BGHpA expression cassette of the commercially available (Thermo Fisher Scientific) mammalian expression vector pcDNA3.4. Large-scale preparation of the final expression vectors for transfection was performed using Maxi- or Megaprep kits (Qiagen).
Commercially available ExpiCHO-S cells (Thermo Fisher Scientific) were transfected with the vectors expressing full length MET using the ExpiFectamine CHO transfection agent according to the manufacturer's instructions. One day after transfection, the cell cultures were used for dose-dependent cell binding analysis or cryopreserved for later use in binding assays.

Groothuis P.G., Jacobs D.C., Hermens I.A., Damming D., Berentsen K., Mattaar-Hepp E., Stokman M.E., van Boekel T., Rouwette M., van der Vleuten M.A., Sesink A., Dijcks F.A., Coumans R.G., Schouten J., Glaudemans D.H., van Wijk D., Blomenröhr M., Kappers W.A., Ubink R., van der Lee M.M, & Dokter W.H. (2023). Preclinical Profile of BYON3521 Predicts an Effective and Safe MET Antibody–Drug Conjugate. Molecular Cancer Therapeutics, 22(6), 765-777.

+ Open protocol

+ Expand

Production and Purification of RNA Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA constructs were cloned and produced as described previously (Grigg et al., 2013 (link); Ke and Doudna, 2004 (link)). Sequences were cloned into the pUC19 plasmid and were preceded by a T7 RNA polymerase promoter and followed by the hepatitis δ virus ribozyme (HDV) to produce homogeneous ends. Guanosine residues were added at the beginning of each to increase expression. Plasmid templates for transcription were prepared with Qiagen MegaPrep kits and linearized by restriction digestion after the HDV sequence. 10 mL in vitro transcription reactions were performed as previously (Ke and Doudna, 2004 (link)). RNA was then purified by urea denaturing PAGE. The yybP-ykoY bands were eluted into water at 4° C overnight. RNA was buffer-exchanged to water and refolded at 2–5 μM by heating at 65° C for 10 min in 15 mL 10 mM Na cacodylate pH 7, 50 mM NaCl, followed by the addition of 10 mM MgCl₂ and (when appropriate) 0.1 or 2.5 mM MnCl₂. RNA was left at 65° C for an additional 2 min and then placed on ice. Cooled samples were concentrated to 0.2 mM and then used for crystallization.

Price I.R., Gaballa A., Ding F., Helmann J.D, & Ke A. (2015). Mn2+-Sensing Mechanisms of yybP-ykoY Orphan Riboswitches. Molecular cell, 57(6), 1110-1123.

+ Open protocol

+ Expand

Lipid-based Plasmid Transfection Reagents

Check if the same lab product or an alternative is used in the 5 most similar protocols

DOPC was purchased from Avanti Polar Lipids as a solution in chloroform. Pentavalent MVL5,^{88 (link)} PEG2000-lipid,^{26 (link)} RGD-PEG2000-lipid, and RPARPAR-PEG2000-lipid^{76 (link)} were synthesized as previously described. The pGL3 and pGFP plasmids encoding the luciferase and GFP genes were purchased from Promega, and several Rab-GFP plasmids (Rab7,^{89 (link)} Rab9, and Rab11^{90 (link)}) were purchased from addgene.org. Rab5-GFP plasmid was a gift from the Weimbs lab (Molecular, Cellular, and Developmental Biology Department, UCSB). All plasmids were propagated in Escherichia coli and purified using Qiagen Giga or Mega Prep kits. For microscopy studies, the pGFP plasmid was labeled using the Mirus Bio Label IT Nucleic Acid Labeling Kit with Cy5 (excitation/emission maximum: 649 nm/670 nm). Poly-L-lysine (Sigma-Aldrich) was used to coat glass slides prior to seeding cells for microscopy studies.

Majzoub R.N., Wonder E., Ewert K.K., Kotamraju V.R., Teesalu T, & Safinya C.R. (2016). Rab11 and Lysotracker Markers Reveal Correlation between Endosomal Pathways and Transfection Efficiency of Surface-Functionalized Cationic Liposome–DNA Nanoparticles. The journal of physical chemistry. B, 120(26), 6439-6453.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!