The hepatic mRNA levels of TNF-α, IL-6 and IL-1β was detected by real-time-polymerase chain reaction (RT-PCR). The total RNA of liver tissue was extracted using Ultrapure RNA Kit (Cwbiotech, Beijing, China). The RNA was reverse transcribed into cDNA with PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time, Takara Biomedical Technology, Beijing, China) according to the manufacturer’s instructions. RT-PCR was operated with a QTOWER3G system (Analytic Jena AG, Jena, Germany). The multiple changes between the mRNA levels in the treatment groups and the untreated group were corrected by the level of β-actin. The relative expression of mRNA was expressed by 2−ΔΔCt and normalized to β-actin, an internal control gene. All target genes were repeated three times. The primers used are listed in Table 2 .
Primescript rt reagent kit with gdna eraser perfect
Manufactured by Takara Bio
Sourced in China, Japan
The PrimeScript™ RT reagent Kit with gDNA Eraser is a laboratory equipment product designed for reverse transcription and genomic DNA removal. It provides the necessary reagents for efficient RNA-to-cDNA conversion and the elimination of genomic DNA contamination in RNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Sybr premix ex taq 2 tli rnaseh plus, by Takara Bio (3 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (2 mentions)
Rnaiso plus, by Takara Bio (2 mentions)
Tb green premix ex taq 2 tli rnaseh plus, by Takara Bio (2 mentions)
Tb green premix ex taq tli rnaseh plus, by Takara Bio (2 mentions)
Iq5 real time pcr detection system, by Bio-Rad (2 mentions)
Novostart sybr qpcr supermix, by Novoprotein (2 mentions)
Ultrapure rna kit, by CWBIO (1 mentions)
Rnaprep pure kit, by Tiangen Biotech (1 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taqtm, by Takara Bio (1 mentions)
Column plant rnaout 2.0 kit, by Tiandz (1 mentions)
T100 system, by Bio-Rad (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions)
Origin software, by OriginLab (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Rnasimple total rna kit, by Tiangen Biotech (1 mentions)
Sybr premix ex taqtm 2 kit, by Takara Bio (1 mentions)
Bca protein assay kit kgp902, by Keygene (1 mentions)
29 protocols using primescript rt reagent kit with gdna eraser perfect
1
Hepatic mRNA Expression Profiling
2
Total RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA from all the tissue samples was isolated using RNAprep Pure Kit (code no. DP441; Tiangen, Beijing, China) accordance with manufacturer’s instructions. An additional step using chloroform–isoamyl alcohol (24:1) was performed to remove the protein contaminants. In the kit, the total RNA and DNA were bound to the membrane, and the DNA was digested by DNase I. Subsequently, the DNA fragments were washed away, and the total RNA was purified. RNA concentration and quality were measured using NanoDrop. Only high-quality samples (260/280 ratios of 1.9 to 2.1) were used for the analysis. The integrity of the RNA samples was determined on a 2% agarose gel. Moreover, every RNA sample was tested via PCR by using the primers (5′-CAGTGGTGGTTCCACTATGTTCC-3′ and 5′-CAAAATGATTGCGAGGAAAGTAA-3′) designed to amplify a 482-bp genomic fragment of an ACT gene (cassava4.1_009807). Samples with no PCR production of the genomic contamination were further analyzed.
PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time; TAKARA, Dalian, China) was used in cDNA synthesis. The first strand of cDNA was synthesized with 600 ng of total RNA in a final reaction volume of 20 μl, following the manufacturer’s instructions.
PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time; TAKARA, Dalian, China) was used in cDNA synthesis. The first strand of cDNA was synthesized with 600 ng of total RNA in a final reaction volume of 20 μl, following the manufacturer’s instructions.
3
Quantitative Analysis of Citrus Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples of 100 mg were taken from ovary walls and fruit exocarps containing secretary cavities at the different developmental stages (H1–H10), and from mature mesocarps without secretary cavities, and total RNA was extracted using a Column Plant RNAout 2.0 kit (TIANDZ) according to the manufacturers’ protocol. The RNA concentration was determined using a Nanodrop 2000 spectrophotometer (ThermoFisher Scientific). First-strand cDNA was generated by reverse transcription from 1 μg of total RNA using a PrimeScriptTM RT Reagent Kit with gDNA Eraser (Perfect Real Time) (Takara) in a 20-μl reaction volume. Quantitative real-time PCR (qRT-PCR) was performed using the method described by He et al. (2018) (link) with SYBR Pre-mix Ex TaqTM (Takara) with a T100 system (BioRad, USA). Three biological and three technical replicates were used for each experiment.
Expression was examined for the Ca2+-dependent DNase gene CgCaN of Citrus grandis ‘Tomentosa’, the calmodulin (CaM) gene PICBP, and the family of Ca2+-dependent CDPK genes CDPK5, CDPK5-like, and CDPK7 of Citrus sinensis. Actin was used as the internal reference, and the primers used are listed inSupplementary Table S1 .
Expression was examined for the Ca2+-dependent DNase gene CgCaN of Citrus grandis ‘Tomentosa’, the calmodulin (CaM) gene PICBP, and the family of Ca2+-dependent CDPK genes CDPK5, CDPK5-like, and CDPK7 of Citrus sinensis. Actin was used as the internal reference, and the primers used are listed in
4
Quantification of Panx1 and Panx2 mRNA in Brain Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction of total RNA[CCx(n=8), FCDIa(n=8), FCDIIa(n=8) and FCD IIb (n=8)]from the brain tissues used RNAiso Plus (TaKaRa, Japan), and then reverse transcribed into cDNA used PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). The relative quantification of Panx1 and Panx2 mRNA levels compared with the internal control gene β-actin were calculated according to the 2 (-ΔΔC(T)) method. For quantitative real-time PCR, gene specific primers were designed as follows: ACTIN: 5'-GCACCACACCTTC TACAATGAGC-3'and 5'-TAGCACAGCCTGGATAGCAACG-3'. Panx1: 5'-CATCTTCCAGTTGCTCAGTGTC-3'and 5'- GCCAAGGTTTGTCAGGAGTAG -3'. Panx2: 5'-ACCTGTTCGAGAAGTACCTGGAG-3' and 5'-GTTGACGAGGATGATGAGGTTC-3'. The amplification system was followed according to the instruction of PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa) on CFX Connect™ Real-Time PCR Detection System (Bio-Rad). The PCR thermocycling conditions were as follows: 95°C for 10min, followed by 35 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 30s. All of the samples were run in triplicate, and the relative quantification of each target gene expression was performed twice.
5
Validating RNA-Seq Gene Expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of ten genes were randomly selected for validation by qPCR. RNA was extracted from the leaves of independent biological replicates for each of CK12 h, CK24 h, CK48 h, T12 h, T24 h and T48 h were employed for qPCR validation. The PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa) was used to remove the gDNA and synthesize cDNA as the template for qPCR. Gene copy specific primers for qPCR were designed based on the corresponding sequence on Primer Premier 5 software (Table S9 ) and synthesized by TSINGKE (Chengdu, China). The reaction was performed on CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The program began at 95 °C for 5 min, followed by 40 cycles of 95 °C for 10 s and 55 °C for 30 s. The reference gene EF-1α (LOC107826390) was used as an internal control [70 (link)]. The 2−ΔΔCt method was used to evaluate the relative levels of gene expression [71 (link)]. The relative gene expression data of qPCR and the differential expression data of RNA-Seq were combined for regression analysis by Origin software (OriginLab, Northampton, MA, USA) to verify the results of gene expression of RNA-Seq.
6
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eighteen genes were randomly selected and verified by quantitative real-time PCR (qRT-PCR). The TaKaRa Prime Script TMRT Reagent Kit with gDNA Eraser (Perfect Real Time; TaKaRa, Shiga, Japan) was used to synthesize cDNA according to the manufacturer’s instructions. qRT-PCR was performed using SYBR Premix Ex Taq™ II (TaKaRa, Shiga, Japan). The 20 µl mixtures for PCRs consisted of 10 µl of 2× SYBR Green II Mix, 0.4 µl of each forward and reverse primer, 2 µl of cDNA, and 7.2 µl of ddH2O. The PCR program was 94 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s. Three biological replicates were conducted for each sample. The relative expression levels were calculated using the 2−ΔΔCt method [26 (link)]. Specific primers for qRT-PCR were designed using Primer 5.0 software (Table S1 ). GAPDH was used as a reference gene [27 (link)].
7
Bovine Mammary Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated from homogenized bovine mammary gland tissues (10–15 mg) or cultured MAC-T cells using the RNAsimple Total RNA Kit (Tiangen, Beijing, China), and 1 μg RNA was reverse transcribed using the PrimeScript TM RT Reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, Dalian, China). The specificity of the PCR product was confirmed by melting curve analysis. All qRT-PCR assays were performed in triplicates in three independent experiments. The primer sequences are listed in Supplementary Table S1 . The expression levels of the target mRNAs were normalized to the internal control β-actin mRNA for each transfection, and the 2–ΔΔCT method was used to calculate the relative abundance of mRNA. The results are representative of at least three independent experiments to determine the statistical significance in both the overexpression and knockdown systems.
8
Grape RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from frozen leaves using a CTAB-based method [42 (link)]. First-strand cDNA was synthesized with a PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, Dalian, China). The primer pairs of SAGs for RT-qPCR were designed using Primer 6.0 and are listed in Supplementary Table S1 . The RT-qPCR protocol was performed based on the manufacturer’s instructions with the SYBR Premix ExTaqTM II kit (Takara, Beijing, China) using the CFX Connect Real-Time PCR Detection System (Bio-Rad). ACTIN from grapes was used as a reference gene. The relative expression was calculated using the 2−ΔΔCt method [43 (link)].
9
Oxidative Stress Markers Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A lipid peroxidation MDA assay kit (S0131) and a hydrogen peroxide assay kit (s0038) as well as a total glutathione peroxidase assay kit (s0058) were purchased from Beyotime Biotechnology (Shanghai, China). BCA protein assay kit (KGP902) and ECL detection kit were purchased from KeyGENE (Nanjing, China). PrimeScript™ RT reagent kit with gDNA Eraser (Perfect Real Time) (code number RR047A) and SYBR® Premix Ex Taq™ II (Tli RNaseH Plus) (code number RR820A) were purchased from TaKaRa. β-Actin monoclonal antibody was purchased from Zhongshan Jinqiao (Beijing, China). Rabbit polyclonal NOX4 antibody (14347-1-AP) and rabbit polyclonal AGTR1 antibody (25343-1-AP) were purchased from Proteintech (Wuhan, China). NF-κB-p65 antibody and NF-κB-pp65 (ser536) antibody were obtained from Wanleibio (Shenyang, China). Rabbit polyclonal TNF-α antibody was purchased from Bioworld (Nanjing, China). Rabbit polyclonal ACE antibody was purchased from ABclonal (Wuhan, China).
10
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were treated or infected as indicated. Then, total RNA was extracted using TRIzol Reagent (Sangon Biotech, Shanghai, China). Reverse transcription was performed using PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa Bio, Tokyo, Japan). Synthetic cDNA was analyzed for quantitative real-time PCR using TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) (TaKaRa Bio) in a LightCycler® 96 System (Roche, Basel, Switzerland). Relative mRNA values were calculated using the 2−∆∆CT method. β-actin was used as an internal control in each sample and showed as fold change by normalizing to the mock-control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!