The degree of ileal cells apoptosis in the intestinal tissue was assessed using the TUNEL assay as described before [1 (link),3 (link)]. The TUNEL assay detected the late phase of cellular apoptosis based on the fragmentation of nucleic acids. In brief, ileal tissue slides were deparaffinized three times with xylene wash and then rehydrated with 100%, 95%, and 70% ethanol. The tissues were then incubated at 37 °C for 90 min with the TUNEL solution (5 μM Fluorescein-12-dUTP (Enzo Life Sciences), 10 μM dATP, 1 mM pH 7.6 Tris-HCl, 0.1 mM EDTA, 1U TdT enzyme (Promega)). For nucleus visualization, the slides were counter-stained utilizing DAPI. Using a Nikon TS2 fluorescent microscopy, the fluorescent green apoptotic cells were examined and imaged.
384 well real time pcr system
The 384-well Real-Time PCR System is a laboratory instrument designed for high-throughput quantitative real-time PCR analysis. It features a 384-well thermal block for efficient processing of multiple samples simultaneously. The system utilizes fluorescence detection to monitor the amplification of target DNA sequences in real-time.
Lab products found in correlation
5 protocols using 384 well real time pcr system
Quantification of NE-induced Inflammatory Gene Expression and Ileal Cell Apoptosis
The degree of ileal cells apoptosis in the intestinal tissue was assessed using the TUNEL assay as described before [1 (link),3 (link)]. The TUNEL assay detected the late phase of cellular apoptosis based on the fragmentation of nucleic acids. In brief, ileal tissue slides were deparaffinized three times with xylene wash and then rehydrated with 100%, 95%, and 70% ethanol. The tissues were then incubated at 37 °C for 90 min with the TUNEL solution (5 μM Fluorescein-12-dUTP (Enzo Life Sciences), 10 μM dATP, 1 mM pH 7.6 Tris-HCl, 0.1 mM EDTA, 1U TdT enzyme (Promega)). For nucleus visualization, the slides were counter-stained utilizing DAPI. Using a Nikon TS2 fluorescent microscopy, the fluorescent green apoptotic cells were examined and imaged.
Quantifying Inflammatory Gene Expression
Quantification of Gut Microbiome Phyla
Comparative Analysis of Rugose and Smooth Morphotypes in Salmonella Typhimurium
Evaluating Host Immune Response in Ileal Tissue
C. perfringens virulent DNA genes and 16S (internal control) were detected using real-time PCR and the primer sequences were: netB_forward: GGAAAAATGAAATGGCCTGA; netB_reverse: GCACCAGCAGTTTTTCCTTC; cpe_forward: CAACTGCTGGTCCAAATGAA; cpe_reverse: GCATCTTTCGCCAGTTTCAA; 16S_forward: AGGAGCAATCCGCTATGAGA; 16S_reverse: GTGCAATATTCCCCACTGCT.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!