Mini-prep alkaline extraction was used to isolate the plasmid [41 ]. The tris-borate EDTA (TBE) buffer was used for agarose gel electrophoresis. We added 1% agarose (stock solution of 10 mg/mL) to the TBE buffer and 5 µL of ethidium bromide (stock solution of 10 µg/mL) to make gels. The agarose gel was run for two hours at 90 mV with 100 µL of MgCl2 (100 mM), 10 mM EDTA, and a loading buffer (5 µL). For this experiment, we used the same gel to run both the marker plasmid and a reference DNA sample. We then used BamH I, EcoR I, and Hind III (Roche Diagnostics GmbH in Mannheim, Germany) endonuclease enzymes for the digestion of plasmid, as well as 1 µL of the high salt digestion buffer (1 M NaCl and 500 mM Tris-HCl), 2 µL of deionized water, 1 µL of the pure DNA sample, and 2 µL of an endonuclease enzymes digestion buffer (pH 7.5).
Bamhi
Manufactured by Roche
Sourced in Germany, Switzerland
BamHI is a type II restriction endonuclease enzyme that recognizes and cleaves the palindromic DNA sequence 5'-GGATCC-3'. It is commonly used in molecular biology laboratories for DNA manipulation and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Ecori, by Roche (4 mentions)
Hindiii, by Roche (3 mentions)
T4 dna ligase, by Roche (3 mentions)
Xhoi, by Roche (3 mentions)
Xbai, by Roche (2 mentions)
Pegfp c3, by Takara Bio (1 mentions)
Pcmv lifeact taggfp2, by Ibidi (1 mentions)
Lipofectamine ltx, by Thermo Fisher Scientific (1 mentions)
Hygromycin b, by Thermo Fisher Scientific (1 mentions)
Fugene hd reagent, by Promega (1 mentions)
Xbai, by Promega (1 mentions)
Anti flag m2 affinity resin, by Merck Group (1 mentions)
Bathophenanthroline, by Merck Group (1 mentions)
Dithioerythritol, by Merck Group (1 mentions)
Expand high fidelity taq polymerase, by Roche (1 mentions)
Dntp mix, by Thermo Fisher Scientific (1 mentions)
Ampicillin a9518, by Merck Group (1 mentions)
Amberlite xad4, by Merck Group (1 mentions)
Na2so4, by Merck Group (1 mentions)
Bamhi xhoi, by Takara Bio (1 mentions)
12 protocols using bamhi
1
Plasmid Isolation and Restriction Digestion
2
Cloning and Imaging of Rab GTPases
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Murine cDNA for Rab5 was amplified from plasmid (OriGene, Rockville, MD) using proofreading KOD polymerase (Merck Millipore, Darmstadt, Germany) with the primers (Eurofins Genomics, Ebersberg, Germany) 5′ GCCGCCGAATTCCCATGGCTAATCGA 3′ and 5′ GAGCGGCCGGGATCCTAGTTACTACA 3′, generating flanking EcoRI and BamHI (Roche, Welwyn Garden City, United Kingdom) sites for cloning into pEGFP-C3 (Clontech, Mountain View, CA). Rab7 cDNA was digested from plasmid (OriGene) with SgfI and MluI (Roche) for cloning into pCMV-AN-tRFP (OriGene). Expression constructs were verified by sequencing (DNA Sequencing Services, University of Dundee, United Kingdom). RAW264.7 macrophages were transfected with pEGFP-Rab5, pCMV-AN-tRFP-Rab7, and commercially available pCMV-LifeAct-TagGFP2 (ibidi, Munich, Germany), using Lipofectamine LTX (Invitrogen) in antibiotic-free medium for 20 h prior to live-cell imaging.
3
Recombinant IL-10 Protein Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nucleotide sequences for the BPSV, RDPV, PCPV, and GSPV IL-10 genes were modified in SnapGene to include the Kozak translation initiation sequence at the N-terminal methionine and the FLAG octapeptide sequence followed by a stop codon at the C-terminus, flanked by the restriction enzyme sites for BamHI and XbaI, respectively (Table S1 ). Modified genes in the pUC57 plasmid were ordered from GenScript (Piscataway, NJ, USA). The vectors containing the IL-10 genes were digested with BamHI and XbaI (Roche, Basel, Switzerland), then the gene fragments were ligated into the BamHI and XbaI sites generated in the expression vector, pAPEX-3.
HEK-293-EBNA cells were transfected with pAPEX-3-IL-10 constructs using FuGENE®-HD reagent (Promega, Madison, WI, USA), then selected using hygromycin B (Gibco, Gaithersburg, MD, USA). Conditioned medium was collected and clarified by centrifugation prior to purification of the FLAG-tagged IL-10 proteins by affinity chromatography with anti-FLAG® M2 affinity resin (Sigma-Aldrich, St. Louis, MO, USA). FLAG-tagged human and ORFV IL-10 were produced in a similar manner, as previously described [33 (link),42 (link)].
HEK-293-EBNA cells were transfected with pAPEX-3-IL-10 constructs using FuGENE®-HD reagent (Promega, Madison, WI, USA), then selected using hygromycin B (Gibco, Gaithersburg, MD, USA). Conditioned medium was collected and clarified by centrifugation prior to purification of the FLAG-tagged IL-10 proteins by affinity chromatography with anti-FLAG® M2 affinity resin (Sigma-Aldrich, St. Louis, MO, USA). FLAG-tagged human and ORFV IL-10 were produced in a similar manner, as previously described [33 (link),42 (link)].
4
Transgenic Poplar Production and Pathogen Resistance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E. coli TOP10 strains were used for subcloning and E. coli BL21 (DE3) was used as the expression strain. A PET-32a plasmid containing BamHI and NotI restriction sites was purchased from Life Sensors (Malvern, PA, USA) for use as a prokaryotic expression vector, and PGWB9 (accession number AB289772) was used to construct the plant expression vector. Leaf disks from Populus deltoides × Populus euramericana ‘Nanlin895’ seedlings were prepared for transformation and precultured in 1/2 Murashige and Skoog (MS) medium. A. tumefaciens strain EHA105 was purchased from the Solarbio Bioengineering Institute (Beijing, China) and used to mediate poplar transformation. Aspergillus niger, Alternaria Nees, Mucor corymbifer, Marssonina populi, Rhizopus sp., and Neurospora crassa were obtained from the Institute of Microbiology at the Chinese Academy of Sciences. S. populiperda cells were kindly provided by Professors Zhu, respectively, at Nanjing Forestry University. BamHI and NotI restriction enzymes and T4 DNA ligase were purchased from Roche (Basel, Switzerland). A Gateway homologous recombination kit was purchased from Invitrogen (Carlsbad, CA, USA). All other reagents were purchased from the Nanjing Jiancheng Bioengineering Institute (Nanjing, China).
5
Molecular Biology Reagents and Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Designed oligonucleotides and DNA extraction kits (product codes: 27104 and 28104) were ordered from Qiagen. Expand High fidelity Taq polymerase (11732641001), T4 DNA ligase (10716359001), HindIII (10656321001), and BamHI (10 656 275 001) were from Roche Diagnostics (Mannheim, Germany). NdeI (R0111S) was from New England Biolabs and the dNTP mix (18427013) from Invitrogen. Tryptone (211921), yeast extract (212750), and sodium (2-sulfonatoethyl)-methanethiosulfonate (MTSES, AM3720 INTERCHIM) were from Thermo Fisher. Amberlite XAD-4 (06444), ampicillin (A9518), bathophenanthroline (146617), diamide (D3648), dithioerythritol (D8255), egg yolk phospholipids (lecithin from eggs, 61755), Na2SO4 (239313), N-dodecanoylsarcosine (sarkosyl, L512), N,N′-1,2-phenylenedimaleimide (o-PDM, 104590), N,N′1,3-phenylenedimaleimide (m-PDM, 160458), PIPES (P6757), phenylarsine oxide (PAO, P3075) pyridoxal-5’-phosphate (82870), sephadex G-75 (17-0050-01), and Tris base (10708976001) triton X-114 (93422) were from Sigma-Aldrich. The radioactive substrates 2-Oxo [1-14C]glutaric acid (NEC597) and 14C-NAD+ (NEC831) were purchased from Perkin Elmer, and [8-3H]GTP (TRK314) from Amersham Biosciences. All reagents were of analytical grade.
6
Cloning RafCAAX into Retroviral Vector
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RafCAAX fragment (~2.0 kb) was digested out with XhoI/BamHI from pCMV‐RafCAAX vector (Takara Bio, Shiga, Japan) and inserted into pMSCV‐neo retroviral vector (Takara Bio) digested with XhoI/BglII to get the retroviral expression vector for RafCAAX (pMSCV‐RafCAAX‐neo). XhoI, BamHI, and BglII were purchased from Roche (Basel, Switzerland).
7
Cloning and Characterization of Mcl-1 and P32 Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human Mcl-1 gene was kindly provided by Dr. Steven W. Edwards from the University of Liverpool [21 (link)]. Mcl-1 was amplified with primers: Forward 5′-CCGGAATTCCGATGTTTGGCCTCAAAAGAAACG-3′ and Reverse 5′-CGCG-GATCCCGCTATCTTATTAGATATGCCAAAC-3′. Then the amplified Mcl-1 was cloned into a pEGFP-C3 vector (Clontech) using EcoR I and BamH I (Roche).
The human P32 gene construct pYW59, encoding the Flag-tagged P32/TAP (1–282) gene, was kindly provided by Dr. S. Diane Hayward from the Johns Hopkins School of Medicine [23 (link)]. P32 was then cloned into a pEYFP-N1 vector (Clontech) with primers: Forward 5′-CCGCTCGAGATGCTGCCTCTGCTGCGCTG-3′ and Reverse 5′-GGAATTCCCTGGCTCT-TGACAAAACTCTTG-3′. The truncation mutants of GFP-Mcl-1 and F3 fused P32-YFP were generated by the same method as described above (Table 1 ).
The human P32 gene construct pYW59, encoding the Flag-tagged P32/TAP (1–282) gene, was kindly provided by Dr. S. Diane Hayward from the Johns Hopkins School of Medicine [23 (link)]. P32 was then cloned into a pEYFP-N1 vector (Clontech) with primers: Forward 5′-CCGCTCGAGATGCTGCCTCTGCTGCGCTG-3′ and Reverse 5′-GGAATTCCCTGGCTCT-TGACAAAACTCTTG-3′. The truncation mutants of GFP-Mcl-1 and F3 fused P32-YFP were generated by the same method as described above (
8
Genomic DNA Extraction and Southern Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To extract genomic DNA, Xcg cells grown on TSA medium were subcultured into TSB medium (casein peptone 17 g, soya peptone 3 g, sodium chloride 5 g, dipotassium hydrogen phosphate 2.5 g, glucose 2.5 g in 1 liter distilled water) in a 28°C shaking incubator for 24 h. Bacterial DNA was extracted from 1 ml of cells grown to an optical density at 600 nm (OD600) of 0.8 to 1.0 using a commercial genomic DNA extraction kit (iNtRON Biotechnology, Inc., Seongnam, Korea) and the protocol for Gram-negative bacteria. The concentration of extracted DNA was estimated using a spectrophotometer (BioDrop Duo, Biochrom Ltd., Cambridge, UK).
For Southern blot analysis, genomic DNA of Xcg was digested with the restriction enzyme BamHI (New England Biolabs, Ipswich, MA, USA). Electrophoretic separation and transfer to nylon membranes were performed as described (Sambrook et al., 1989 ). For DNA hybridization, a digoxigenin (DIG)-labeled avrBs3 gene probe was used; this probe was comprised of a 3.3-kb internal BamHI fragment of avrBs3 cloned into pBlueScript, as described previously (Park et al., 2008 (link)), using a commercial protocol for DIG-labeled probes and membrane hybridization (Roche Diagnostics, Mortsel, Belgium). Detection of hybridization was performed using an anti-DIG antibody (Roche Diagnostics) and subsequent exposure to an X-ray film (Agfa CP-BU new).
For Southern blot analysis, genomic DNA of Xcg was digested with the restriction enzyme BamHI (New England Biolabs, Ipswich, MA, USA). Electrophoretic separation and transfer to nylon membranes were performed as described (Sambrook et al., 1989 ). For DNA hybridization, a digoxigenin (DIG)-labeled avrBs3 gene probe was used; this probe was comprised of a 3.3-kb internal BamHI fragment of avrBs3 cloned into pBlueScript, as described previously (Park et al., 2008 (link)), using a commercial protocol for DIG-labeled probes and membrane hybridization (Roche Diagnostics, Mortsel, Belgium). Detection of hybridization was performed using an anti-DIG antibody (Roche Diagnostics) and subsequent exposure to an X-ray film (Agfa CP-BU new).
9
Cloning and Purification of BmLDH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both BmLDH PCR product and pGEX-6P-1 expression vector were double digested with BamHI (Roche, Germany) and XhoI (Roche) restriction enzymes. The digested BmLDH and pGEX-6P-1 were ligated and transformed into competent E. coli BL21 (Invitrogen, Japan). The nucleotide sequence of the cloned BmLDH was confirmed using pGEX-6P-1 forward and reverse sequencing primers with automated sequencer (ABI Prism 3100 Genetic Analyzer, USA).
The recombinant BmLDH was expressed in E. coli BL21 as glutathione S-transferase fusion protein. The soluble fraction of the recombinant protein was purified as previously described21 with minor modifications. PreScission™ Protease (GE Healthcare, Sweden) was used to cleave BmLDH from Glutathione-Sepharose™ 4B beads to yield GST-free BmLH for enzyme kinetic assay. The purity and concentration of the purified protein were determined using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Lowry protein assay kit (Thermo Scientific, USA).
The recombinant BmLDH was expressed in E. coli BL21 as glutathione S-transferase fusion protein. The soluble fraction of the recombinant protein was purified as previously described21 with minor modifications. PreScission™ Protease (GE Healthcare, Sweden) was used to cleave BmLDH from Glutathione-Sepharose™ 4B beads to yield GST-free BmLH for enzyme kinetic assay. The purity and concentration of the purified protein were determined using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Lowry protein assay kit (Thermo Scientific, USA).
10
Genome-wide DNA Methylation Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were transfected and/or treated as indicated in figure legends. A total of ~5 × 106 cells were harvested and Genomic DNA extracted as described above. Ten micrograms of total genomic DNA was digested in 200 μl for 16 h with Restriction Endonuclease mix containing 30 U each of Eco RI, Bam HI, Hind III, XbaI, Sal I (Roche Applied Science), phenol/chloroform extracted, ethanol precipitated and resuspended in 50 μl of TE buffer. An aliquot (1/10) of digested DNA was used as input control to determine DNA concentration and digestion efficiency. MeDIP was performed essentially as described32 (link) except that 2 μg of antibody specific for 5 mC (Abcam) were used to precipitate methylated DNA from 5 μg of total genomic DNA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!