Amplitaq gold polymerase

Manufactured by PerkinElmer

Sourced in United States

AmpliTaq Gold polymerase is a thermostable DNA polymerase used in polymerase chain reaction (PCR) amplification. It exhibits 5' to 3' exonuclease activity and can be used for a variety of PCR applications.

Automatically generated - may contain errors

Lab products found in correlation

Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (4 mentions) Linear array hpv genotyping test, by Roche (3 mentions) Exosap it, by GE Healthcare (2 mentions) Abi 3130xl genetic analyzer, by Thermo Fisher Scientific (2 mentions) Gc rich pcr system, by Roche (1 mentions) Monarch dna gel extraction kit, by New England Biolabs (1 mentions) Isolate faecal dna kit, by Meridian Bioscience (1 mentions) Ez dna methylation gold kit, by Zymo Research (1 mentions) Dna free dnase, by Thermo Fisher Scientific (1 mentions) Iq sybr green master mix, by Bio-Rad (1 mentions) Abi prism 7300, by Thermo Fisher Scientific (1 mentions) Geneamp pcr system, by PerkinElmer (1 mentions) Abi prism 3100 genetic analyzer, by Thermo Fisher Scientific (1 mentions) Revertra ace, by Toyobo (1 mentions) Topo ta cloning kit for sequencing, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

AmpliTaq Gold (22 citations) AmpliTaq Gold DNA polymerase (9 citations) AmpliTaq polymerase (2 citations)

13 protocols using amplitaq gold polymerase

Multiplex Assay for HPV Antibodies

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sexually transmitted infection (STI) testing methods for chlamydia, gonorrhea, syphilis, and HSV-2 have previously been reported [15] . For HPV analyses, DNA was extracted from cervical cell specimens using the Qiagen Media Kit and amplified by polymerase chain reaction (PCR) with the PGMY09/11 L1 consensus primer system and AmpliTaq Gold polymerase (Perkin-Elmer) [15] , [16] (link). HPV genotyping was conducted on all specimens, regardless of PCR results, using the Linear Array HPV Genotyping Test (Roche Diagnostics), which detects 37 HPV genotypes [18] (link), [19] (link).
Sera were collected at Day 1 and Month 7 for assessment of HPV neutralizing antibody levels. Immune response was measured using a multiplex competitive Luminex immunoassay (anti-HPV-6, −11, −16, −18, −31, −33, −45, −52, and −58 cLIA; Merck) at Pharmaceutical Product Development, Inc [20] (link). This assay simultaneously quantitates neutralizing antibodies to nine HPV types based on the L1 capsid antigen in 50 μL of serum. Antibody levels were reported as milli-Merck units (mMU) per milliliter (mL) serum. Cut points for determination of antibody positivity for HPV 6, 11, 16, 18, 31, 33, 45, 52, and 58 were 16, 6, 12, 8, 4, 4, 3, 3, and 4 mMU/mL, respectively.

Sudenga S.L., Torres B.N., Botha M.H., Zeier M., Abrahamsen M.E., Glashoff R.H., Engelbrecht S., Schim Van der Loeff M.F., Van der Laan L.E., Kipping S., Taylor D, & Giuliano A.R. (2017). HPV serostatus pre- and post-vaccination in a randomized phase II preparedness trial among young Western Cape, South African women: The evri trial. Papillomavirus Research, 3, 50-56.

+ Open protocol

+ Expand

RT-PCR Analysis of RET and Ligand Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT-PCR analysis was performed with the following RET primers: RET225 5′-GGCTGCGTCTGCTGTGC TG and RET466 5′-AAGGTGAGGAGGCCGGTGTC, covering sequences encoding extracellular parts, RET 2185 5′-GCCCACAGCCACCCAT and RET 2469 5′-GGA GGCGTTCTCTTTCAGCATC, covering transmembrane encoding parts, RET2738 5′-TGGGCGACCTCATCTC ATTTG and RET3271 5′-AGGCCGTCGTCATAAATC AGGGAG, covering the tyrosine kinase encoding sequences of RET mRNA. For the analysis of ligand transcripts, the GDNF specific primers GDNFfwd 5′-ATGTCGTGGCTGTCTGCCTGG and GDNFrev 5′-CATCGCAAGAGCCGCTGCAG, the PSPN specific primers PSPN90fwd 5′-CGTGGCCGATGGAGAGTT CTC and PSPNrev 5′-AAGGCCACGTCGGTGTAGCG, the NRTN specific primers NTNfwd 5′-AGAGGGCC TGCTTCTCAGCC and NTNrev 5′-TAGCGGAACAGC ACCGTCTCG, and the ARTN specific primers ARTNfwd 5′-TGCTGAGCAGCGTCGCAGAGG and ARTNrev 5′-AGGAGCCGCTGCAGAAGCGG, were used. To avoid amplification of contaminating genomic DNA, all primer pairs were designed to amplify cDNA fragments that spanned over one or several exon borders. Unigene representative sequences were used as template for primer design. PCR was run for 35 cycles using a GCRICH PCR system (Roche Diagnostics) and AmpliTaq GOLD Polymerase (Perkin-Elmer) according to the manufacturer's recommendations. PCR detection of FUSDDIT3 fusion transcripts was performed as previously described [4 (link), 56 (link)].

Safavi S., Järnum S., Vannas C., Udhane S., Jonasson E., Tomic T.T., Grundevik P., Fagman H., Hansson M., Kalender Z., Jauhiainen A., Dolatabadi S., Stratford E.W., Myklebost O., Eriksson M., Stenman G., Stock R.S., Ståhlberg A, & Åman P. (2015). HSP90 inhibition blocks ERBB3 and RET phosphorylation in myxoid/round cell liposarcoma and causes massive cell death in vitro and in vivo. Oncotarget, 7(1), 433-445.

+ Open protocol

+ Expand

Genomic DNA Isolation and PCR Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated from faecal and larynx samples (infected and non-infected, each n = 4) and cultured B. pseudohinzii (n = 1) with the ISOLATE Faecal DNA Kit (Bioline, Luckenwalde, Germany) according to the manufacturer’s protocol. For subsequent PCR, 3 µl of DNA, 2.5 µl buffer II (100 mM Tris-HCl, 500 mM KCl, pH 8.3), 2 µl MgCl₂ (15 mM), 0.75 µl dNTP (10 mM each), 0.75 µl of each primer (10 µM; fwd: cgttccggttgcccagaag, rev: gccttcggcggtcttgttggtc; accession number CP016440; Eurofins, Ebersberg, Germany), 0.25 µl AmpliTaq Gold polymerase (5 U/µl; if not otherwise indicated, all reagents from Perkin Elmer, Langen, Germany) were supplemented with H₂O to a final volume of 25 µl. Cycling conditions were 12 min 95 °C, 40 cycles with 30 s at 95 °C, 30 s at 62 °C, 30 s at 72 °C, and a final extension at 72 °C for 7 min. PCR products were analysed on a 2% agarose gel. For subsequent sequencing, PCR-products were purified by the use of the Monarch DNA Gel Extraction Kit (New England Biolabs, Frankfurt, Germany) as recommended by the manufacturer. Sequencing was done by Eurofins.

Perniss A., Schmidt N., Gurtner C., Dietert K., Schwengers O., Weigel M., Hempe J., Ewers C., Pfeil U., Gärtner U., Gruber A.D., Hain T, & Kummer W. (2018). Bordetella pseudohinzii targets cilia and impairs tracheal cilia-driven transport in naturally acquired infection in mice. Scientific Reports, 8, 5681.

+ Open protocol

+ Expand

Methylation Analysis of Hace1 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

Methylation analysis was carried out in 55 frozen non-neoplastic gastric mucosae and 2 gastric cancer cell lines after transfection with NKX6.3. Methylation status of the promoter region of the Hace1 gene was determined using sodium bisulfite treatment of the DNA followed methylation specific PCR (MSP), as described in the literature with minor modifications^{17 (link)}. 5 μl of the bisulfite-modified DNA was subjected to MSP using two sets of primers for methylated and unmethylated Hace1. The primer sequences are described in Supplementary Table S1. PCR was performed in a total volume of 30 μl, containing 5 μl of the template DNA, 0.5 μM of each primer, 0.2 μM of each dNTP, 1.5 mM MgCI₂, 0.4 unit of Ampli Taq gold polymerase (Perkin-Elmer) and 3 μl of 10X buffer. The reaction solution was initially denatured for 1 min at 95 °C. Amplification was carried out for 40 cycles of 30 s at 95 °C, 30 s at 58 °C and 30 s at 72 °C, followed by a final 5 min extension at 72 °C. Each PCR product was loaded directly onto 2% agarose gels, stained with ethidium bromide and visualized under UV illumination.

Yoon J.H., Kim O., Nam S.W., Lee J.Y, & Park W.S. (2017). NKX6.3 Regulates Reactive Oxygen Species Production by Suppressing NF-kB and DNMT1 Activities in Gastric Epithelial Cells. Scientific Reports, 7, 2807.

+ Open protocol

+ Expand

Bisulfite-Mediated DKK3 Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were collected following 5-aza (10 μM) treatment as described previously [28 (link)]. DNA was extracted and bisulfite-converted using an EZ DNA Methylation-Gold Kit (ZYMO Research, Foster City, CA, USA). All bisulfate-treated DNA samples (1 μg) were amplified using primers specific for the methylated or unmethylated sequence. For the unmethylated reaction, the DKK3 forward primer 5′-TTTTGGTTTTTTTTTGTTTTTGGG-3′ and the reverse primer 5′-CCAAACCACTACATCTCCACT-3′ were used, whereas for the methylated reaction, the DKK3 forward primer 5′-CGGTTTTTTTTCG TTTTCGGG-3′ and the reverse primer 5′-CAAACCGCTA CATCTCCGCT-3′ were used. PCR was performed using a GeneAmp DNA Amplification Kit and AmpliTaq Gold Polymerase (Perkin Elmer, Foster City, CA, USA) with the following conditions: 95°C for 5 min followed by 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 40 s. A total of 10 μL of the PCR product was separated by 2.5% agarose gel electrophoresis and stained with the GoldView I nucleic acid stain for 45 min, and the results were photographed and analyzed.

Zhang Y., Li H., Cao R., Sun L., Wang Y., Fan S., Zhao Y., Kong D., Cui L., Lin L., Wang K., Li Y, & Zhou J. (2017). Suppression of miR-708 inhibits the Wnt/β-catenin signaling pathway by activating DKK3 in adult B-all. Oncotarget, 8(38), 64114-64128.

+ Open protocol

+ Expand

HPV DNA Genotyping by Nested PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Purified HPV DNA was initially genotyped by direct sequencing of PGMY09/11 PCR
amplimers or cloning of these fragments followed by sequencing. Next, 1µl of
PGMY09/11 negative products were used in a nested PCR using GP5+/6+ primers [15 (link)]; positive samples were sequenced following cloning.
Finally, nested PCR negative samples were submitted to a novel amplification reaction
employing FAP59/64 primers [16 (link)], and positive
samples were analyzed exclusively by direct sequencing. AmpliTaq Gold polymerase
(Perkin-Elmer, Foster City, CA, USA) was used in all PCRs. Purification of the amplimers
using the EXO SAP-IT (GE Healthcare, Buckinghamshire, UK) preceded sequencing. Sequencing
was conducted in an ABI 3130XL Genetic Analyzer (AB Applied Biosystems, CA, USA) using the
BigDye Terminator v3.1 Cycle Sequencing kit (AB Applied Biosystems, CA, USA). Sequence
identity was determined through comparison with the BlastN database.

Sichero L., Nyitray A.G., Nunes E.M., Nepal B., Ferreira S., Sobrinho J.S., Baggio M.L., Galan L., Silva R.C., Lazcano-Ponce E., Giuliano A.R, & Villa L.L. (2015). Diversity of human papillomavirus in the anal canal of men: The HIM study. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases, 21(5), 502-509.

+ Open protocol

+ Expand

HPV Genotyping and Antibody Assessment

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sexually transmitted infection (STI) testing methods for chlamydia, gonorrhea, syphilis, and HSV-2 have previously been reported.[15 (link)] For HPV analyses, DNA was extracted from cervical cell specimens using the Qiagen Media Kit and amplified by polymerase chain reaction (PCR) with the PGMY09/11 L1 consensus primer system and AmpliTaq Gold polymerase (Perkin-Elmer).[15 (link), 16 (link)] HPV genotyping was conducted on all specimens, regardless of PCR results, using the Linear Array HPV Genotyping Test (Roche Diagnostics), which detects 37 HPV genotypes.[18 (link), 19 (link)]
Sera were collected at Day 1 and Month 7 for assessment of HPV neutralizing antibody levels. Immune response was measured using a multiplex competitive Luminex immunoassay (anti-HPV-6, -11, -16, -18, -31, -33, -45, -52, and -58 cLIA; Merck) at Pharmaceutical Product Development, Inc.[20 (link)] This assay simultaneously quantitates neutralizing antibodies to nine HPV types based on the L1 capsid antigen in 50 μL of serum. Antibody levels were reported as milli-Merck units (mMU) per milliliter (mL) serum. Cut points for determination of antibody positivity for HPV 6, 11, 16, 18, 31, 33, 45, 52, and 58 were 16, 6, 12, 8, 4, 4, 3, 3, and 4 mMU/mL, respectively.

+ Open protocol

+ Expand

HPV Genotyping from Cervical Specimens

Check if the same lab product or an alternative is used in the 5 most similar protocols

For HPV analyses, DNA was extracted from cervical cell specimens using the Qiagen Media Kit and amplified by polymerase chain reaction (PCR) with the PGMY09/11 L1 consensus primer system and AmpliTaq Gold polymerase (Perkin-Elmer). HPV genotyping was conducted on all specimens, regardless of PCR results, using the Linear Array HPV Genotyping Test (Roche Diagnostics), which detects 37 HPV genotypes (high-risk (HR-HPV): 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68; low-risk (LR-HPV): 6, 11, 26, 40, 42, 53-55, 61, 62, 64, 66, 67, 69-73, 81, 82, 83, 84, 89, IS39).[11 (link)] The Linear Array method cannot detect HPV 52 co-infections in the presence of HPV 33, 35, or 58, so some HPV 52 co-infections may have gone undetected. Five participants with an inadequate amount of sample for HPV detection and six participants that had HPV β-globin negative samples at the enrollment visit were removed from analyses. At the 7-month visit, only two participants had an inadequate amount of sample for HPV testing; specimens from the remaining participants were all β-globin positive. Therefore the final sample size for this analysis was 332 women (vaccine arm n=169 and placebo arm n=163).

Sudenga S.L., Torres B.N., Botha M.H., Zeier M., Abrahamsen M.E., Glashoff R.H., Engelbrecht S., der Loeff M.F., der Laan L.E., Kipping S., Taylor D, & Giuliano A.R. (2015). Cervical HPV Natural History Among Young Western Cape, South African Women: The Randomized Control EVRI Trial. The Journal of infection, 72(1), 60-69.

+ Open protocol

+ Expand

RNA Extraction and RT-PCR Analysis of MR and GR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA extraction from AHP cells and reverse transcription to cDNA from 3 μg RNA were performed as previously described (39 (link)). Nine microliters of cDNA were amplified by standard polymerase chain reaction (PCR) in a 50 μl volume using AmpliTaq Gold Polymerase in a GeneAmp PCR System (Perkin Elmer, Milano, Italy) as described (10 (link)). The following primer pairs were used for both RT-PCR and real time PCR: MR (40 (link)), forward 5′-TACGACAATTCCAAGCCCGACACC-3′, reverse 5′-TACCTTGGCCCACTTCACGACCTG-3′ (99 bp) (NM_013131). GR (40 (link)), forward 5′-AGGGGAGGGGGAGCGTAATGG-3, reverse 5′-CCTCTGCTGCTTGGAATCTGC-3′ (119 bp) (AY293740); rat 18S rRNA, forward 5′-GTGGAGCGATTTGTCTGGTT-3′, and reverse 5′-CGCTGAGCCAGTTCAGTGTA-3′(X01117). Amplification for 18S rRNA subunit was used as internal control. For real-time PCR, cDNA was treated with DNA-free DNAse (LifeTech, Monza, Italy). Real-time PCR was performed with 50 ng cDNA, 100 nmol/L of each primer and the IQ-SYBR-green mastermix (Bio-Rad, Milano, Italy) using the ABI-Prism 7300 (Applied Biosystems).

Gesmundo I., Villanova T., Gargantini E., Arvat E., Ghigo E, & Granata R. (2016). The Mineralocorticoid Agonist Fludrocortisone Promotes Survival and Proliferation of Adult Hippocampal Progenitors. Frontiers in Endocrinology, 7, 66.

+ Open protocol

+ Expand

Isolation and RNA Profiling of Mouse Oocytes, Blastocysts, and Primordial Germ Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Embryos and cells were prepared from appropriately staged strain 129 female mice. After flushing from the oviduct, oocytes were treated with hyaluronidase to remove cumulus cells. Both oocytes and blastocysts were washed extensively to eliminate contaminating cellular debris prior to lysis. Primordial germ cells (PGCs) were isolated from the dissected genital ridges of day 12.5 embryos, using calcium- and magnesium-free phosphate buffered saline (Buehr and McLaren 1993 (link)). Freshly prepared oocytes (n=35), blastocysts (n=30) and PGCs were lysed in Solution D and RNA was purified by acid phenol extraction (Chomczynski and Sacchi, 1987 (link)). To aid recovery of RNA, 20 µg of carrier tRNA was added to the samples prior to extraction. cDNA was prepared from 1/5th of the recovered RNA using random priming and the Superscript Preamplification system. 1/10th of the reverse transcription reaction was then amplified using AmpliTaq Gold polymerase (Perkin Elmer). PCR reactions of 50 cycles were performed using primers that amplify a 184 bp DNA fragment from Gab1β cDNA (GGACCATTCGAGGTGGCAGAC; CAACCCAGCATCAACTTGCTGAC) or a 939 bp DNA fragment from β-actin cDNA (GTGACGAGGCCCAGAGCAAGAG; AGGGGCCGGACTCATCGTACTC).

Sutherland L., Ruhe M., Gattegno-Ho D., Mann K., Greaves J., Koscielniak M., Meek S., Lu Z., Waterfall M., Taylor R., Tsakiridis A., Brown H., Maciver S.K., Joshi A., Clinton M., Chamberlain L.H., Smith A, & Burdon T. (2018). LIF-dependent survival of embryonic stem cells is regulated by a novel palmitoylated Gab1 signalling protein. Journal of Cell Science, 131(18), jcs222257.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!