Crispr crrna

To stably express CAS9 in LNCaP and PC3 cells, we generated a CAS9 (Streptococcus pyogenes CRISPR-Cas) expressing lentivirus (Addgene 65655) from 293T cells. Lentiviral infection efficacy was >90% and cells were maintained with 2 μg/ml puromycin. Two synthetic guide RNAs (gRNAs) (CRISPR crRNA, Integrated DNA Technologies) were designed using the CRISPR Design Tool (crispr.mit.edu), those with off-target effects were excluded. gRNAs were ordered from Integrated DNA technologies as g-blocks (455 bp fragment) that contains U6 promoter, gRNA target sequence, guide RNA scaffold and a termination signal. The sequence for gRNA 1 and 2 is CCCCCTGGTTGTCAAACTCTGGG and GCCTCCCATCAGTCATCCCAG-GG, respectively. They were delivered by transient transfection reagent Lipofectamine. Enhancer knockout was confirmed by genomic DNA PCR using the following primer sequences: F primer—TAAAGGAAAAGGGACTGTGGAA, R primer—CAGGTCTTCTCAGGTCTTTGCT.

CRISPR/Cas9 gene-editing was used to ablate FKBP51 in HaCaT cells. Recombinant Cas9 protein and CRISPR crRNA were purchased from Integrated DNA Technologies (Coralville, IA). The gRNAs were designed using publicly accessible engines (http://crispr.mit.edu/; http://chopchop.cbu.uib.no/ (http://www.uib.no/en/persons/) as described [50 (link)–52 (link)]. Only top ranked gRNA with no off-target effects confirmed by two design sites were selected for the knock-out procedure (gRNA1, FKBP51 exon 2, ATTACCTCCAAAAAAGACAG; gRNA2, FKBP51 Exon 3, GGTGAGGAAACGCCGATGAT; gRNA3, FKBP51 Exon 4, GTCATCAAGGCATGGGACAT). HaCaT cells were transiently transfected with ribonucleoprotein complex (RNPC) using RNAi-Max transfection reagent (Fisher Scientific). The advantages of RNPC (with Cas9 protein and synthetic gRNAs) versus standard vector-based CRISPR approaches include rapid RNPC degradation after gene editing resulting in minimal Cas9-gRNA off-target effects and cytotoxicity. Single-cell colonies were established from CRISPR-edited cell cultures and analyzed by sequencing and Western blotting to verify the knock-out of FKBP51 gene. Cas9-only-treated cells were used as a control. Experiments were performed in two different FKBP51 KO clones (L1 and L2).

To stably express CAS9 in Myc-CaP cells, we generated VSVG pseudotyped lentivirus^{63 (link),64 (link)} using 293T cells, 2nd generation packaging vectors psPAX2, pMD2.G, and a CAS9 (Streptococcus pyogenes CRISPR-Cas) expressing lentiviral vector (Addgene 52962)^{65 (link)}. Lentiviral infection efficacy was >90% and cells were maintained with 8 μg/ml puromycin. Multiple synthetic guide RNAs (gRNAs) (CRISPR crRNA, Integrated DNA Technologies) were designed using the CRISPR Design Tool (crispr.mit.edu^{66 (link)}), those with off-target effects were excluded. gRNAs were delivered by transient transfection reagent TransIT-X2 (Mirus Bio). Partial PTEN knockout was confirmed by PTEN and p-AKT western blot and IF; >40 clones were isolated by cloning cylinders and were screened for complete PTEN loss. Two complete PTEN knockout Myc-CaP clones from different gRNAs (AAAGACTTGAAGGTGTATAC (exon 2), TGTGCATATTTATTGCATCG (exon 5)) were selected and analyzed in parallel in vitro.