Custom oligonucleotides

DNA oligonucleotides were purchased as desalted, dry custom oligonucleotides from Life Technologies (Darmstadt, Germany) and stored at a concentration of about 200 µM in water at 4 °C. A stock solution of 1 mM MgHPO₄ (Alfa Aesar, Haverhill, Massachusetts / USA) was adjusted to pH 7.2 using dilute HCl. The dsDNA samples were prepared by combining Millipore water and ssDNA and MgHPO₄ stock solutions to reach the final concentrations of 10 µM of each ssDNA and 0.5 mM MgHPO₄. This buffer was chosen because its pH remains relatively stable over our temperature range, and it demonstrated sufficient buffer capacity for this sample concentration. dsDNA samples were annealed by heating at 95 °C for 10 min and cooling to room temperature overnight.

RNA was extracted from liquid nitrogen flash-frozen samples and purified using a column-based RNEasy kit (74104, Qiagen). RNEasy Lipid Tissue kit (74804; QIAGEN) was used for RNA extraction of adipose samples. Extracted RNA was quantified and checked for purity using an Implen NanoPhotometer (Implen GmbH, Germany). cDNA was generated from 1μg RNA using iScript Advanced cDNA Synthesis Kit for RT-qPCR (170–8843; Bio-Rad). qPCR was run for ChREBP-α, ChREBP-β, L-PK, ACC, FAS, SREBP1, MondoA, SCD1, PEPCK, TNFα, IL1β, IL6, CD68 and 36B4 (reference gene) (sequences in Table 1) using custom oligonucleotides (MicroMon, Monash University) and SYBR Green PCR Master Mix (4309155, Life Technologies). Amplifications were performed using a Real Plex4 Mastercycler (Eppendorf, Germany) followed by a melt curve analysis.

λ-DNA which consisted of 12 bases overhangs was purchased from New England Biolabs, UK Catalog #3011 S and all designed aptamer probes (Supplementary Figs. 3 and 4) were obtained from Invitrogen custom oligonucleotides. α-thrombin was obtained from Cambridge Biosciences, UK. AChE and HS (from clotted human whole blood) were purchased from Sigma-Aldrich, UK.

For qRT-PCRs, we isolated RNA from samples with TRIzol reagent (Invitrogen, Life Technologies Corporation, Carlsbad, CA, USA). Reverse transcription was done with SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen), primed with random hexamers and following the manufacturers' protocol. Quantitative real-time RT-PCRs were done with the Fast SYBR Green Master Mix (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA, USA) using a 7900HT Fast Real-Time PCR System (Applied Biosystems) in the fast mode. Primer (custom oligonucleotides, Invitrogen) sequences were (all 5′ to 3′): NF-κB1 forward TGGAGTCTGGGAAGGATTTG, reverse CGAAGCTGGACAAACACAGA; TNF forward CCCCAGGGACCTCTCTCTAA, reverse CAGCTTGAG GGTTTGCTACA; BCL2 forward ATGTGTGTGGAGAG CGTCAA, reverse ACAGTTCCACAAAGGCATCC; XIAP forward CATTCACTTGAGGAGTGTCTGG, reverse TGAAACTGAACCCCATTCGT; BIRC3 forward CCAAGTGGTTTCCAAGGTGT, reverse TTTTCATCT CCTGGGCTGTC; BIRC2 forward CCAAGTGGTTT CCAAGGTGT, reverse ATTGGTGGGTCAGCATTTTC; ACTB forward AGAGCTACGAGCTGCCTGAC, reverse AGCACTGTGTTGGCGTACAG.