Four different gRNA sequences were designed to target ESR1: gRNA1: F, CACCGGCGTCGATTATCTGAATTT, R, AAACAAATTCAGATAATCGACGCC; gRNA3: F, CACCCTCCGTAAATGCTACGAAGT, R, AAACACTTCGTAGCATTTACGGAG; gRNA5: F, CACCGGGTCTGAGGCTGCGGCGTT, R, AAACAACGCCGCAGCCTCAGACCC; gRNA6: F, CACCGCCTACGAGTTCAACGCCG; R, AAACCGGCGTTGAACTCGTAGGC. Each gRNA was cloned into an all-in-one pU6-sgRNA-CAS9-P2A-GFP plasmid, which was modified from pX330 (Addgene #42230). All plasmids were sequenced to confirm successful ligation.
Pegfp c1 er alpha
PEGFP-C1-ER alpha is a plasmid vector that encodes an enhanced green fluorescent protein (EGFP) fused to the endoplasmic reticulum (ER) targeting sequence of the calreticulin protein. This vector is designed to express the EGFP-ER fusion protein, which can be used to visualize the ER in living cells.
Lab products found in correlation
4 protocols using pegfp c1 er alpha
Engineered Luciferase Reporter for ESR1
Constructing Estrogen Receptor Dual-Domain Biosensor
Plasmid Transfection Protocol for MDA-MB-231 Cells
Estrogen Receptor Activation Assay in HuLM Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!