Quantstudio 7 flex real time pcr instrument

DENV in sera was determined as previously described, with modification: the DENV-2 probe fluorophore was changed to JOE.[80 (link)] RNA was extracted from sera on days 1–14, 16, 18, and 21 using QIAamp Viral RNA mini on the QIAcube instrument. Eluted RNA was quantified by qRT-PCR using the SuperScript III Platinum One-Step qRT-PCR kit (Thermo Fisher Scientific) on the QuantStudio 7-Flex Real-Time PCR instrument (Thermo Fisher Scientific). DENV RNAemia was calculated as genome equivalents (GE) per mL using an internal standard curve of 10-fold serially diluted in vitro-transcribed RNA. The limit of quantitation, defined here as detection of a standard curve dilution in ≥95% of at least 20 replicate curves tested, for both the DENV-1 and DENV-2 assays is 50 GE/reaction. Values for undetectable samples were replaced with 25 GE/mL for the purposes of statistical analysis and graphing; this value is one-half of a theoretical minimum of one detected copy per reaction multiplied by the assay dilution factor of 50 to achieve per mL concentrations.

RNA was recovered via column purification using RNeasy kit (Qiagen, Hilden, Germany) and cDNA prepared with iScript (BioRad, Hercules, CA, USA). cDNA was amplified by PCR (50 cycles). Taqman primer/probes were used to detect the amplified PCR product in a Quant Studio 7 Flex Realtime PCR instrument (ThermoFisher Scientific). The primer/probes (Thermo Fisher Scientific) include Hs99999905_m1 for GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and Hs00195567_m1 for the human MT-1 receptor.

Total RNA was isolated with Trizol reagent (Invitrogen) according to manufacturer’s guidelines. Reverse transcription was performed with Tetro cDNA Synthesis Kit (Bioline) according to manufacturer’s description. Quantitative PCR was performed with SYBR-green PCR master mix using QuantStudio™ 7 Flex Real-Time PCR Instrument (both Thermo Fisher Scientific) with cycling conditions recommended by the manufacturer. The EEF1A1 raw PCR cycles (CT) values were normalized (ΔCT) to internal control (hypoxanthine phosphoribosyltransferase 1; HPRT1) CT values. Relative mRNA level changes were determined by 2^−ΔΔCT calculation using MCF10A asynchronous cells as controls. Primers used were: HPRT1-forward: TCAGGCAGTATAATCCAAAGATGGT, reverse: AGTCTGGCTTATATCCAACACTTCG^{60 (link)}; EEF1A1-forward: GGACACGTATCGGGCAA, reverse: AGGAGCCCTTTCCCATCTCA.

The total RNA of TET21-N cells (control and 24 h treatment with doxycycline) was extracted using the Monarch Total RNA Miniprep Kit (New England Biolabs, Hitchin, UK), from which complementary DNA (cDNA) was synthesised by reverse transcription using RevertAid RT Reverse Transcription Kit (Thermo Fisher Scientific). qPCR was performed using Maxima SYBR Green/ROX qPCR Master Mix (2×) (Thermo Fisher Scientific) using the QuantStudio 7 Flex Real-Time PCR Instrument (Thermo Fisher Scientific). The relative gene expression was calculated using the comparative Ct method (ΔΔCt). GAPDH was used as the endogenous reference gene.
qPCR was conducted using the following primers: GAPDH Fw, 5′-ACCACAGTCCATGCCATCAC-3′; GAPDH Rev, 5′-TCCACCACCCTGTTGCTGTA-3′; MYCN Fw, 5′-CACAAGGCCCTCAGTACCTC-3′; MYCN Rev, 5′-ACCACGTCGATTTCTTCCTC-3′; CCDC86 Fw, 5′-TTCCTCTCCTGTCGTTCCTT-3′; and CCDC86 Rev, 5′-AGCGAAAAGGTTCTTCATCC-3′.

Heart tissues stored in RNAlater® at -80°C were transferred to Lysing Matrix D and homogenized in FastPrep-24 homogenizer (MP Biomedicals, Santa Ana, CA, USA). Total RNA from the homogenate was extracted using PureLink™ RNA Mini Kit (Thermo Fisher Scientific). Then, cDNA was synthesized from 500 ng of the extracted total RNA and qPCR was performed in QuantStudio™ 7 Flex Real-Time PCR Instrument (Thermo Fisher Scientific). TaqMan gene expression assay probes targeting mouse genes Rara (Mm01296312_m1), Rarb (Mm01319677_m1), Rarg (Mm00441091_m1), Top2a (Mm01296339_m1), Top2b (Mm00493776_m1), and Hprt1 (Mm00446968_m1) were used to perform the qPCR. Each qPCR reaction consisted of 5 μL 2X TaqMan Universal Master Mix, 0.5 μL TaqMan probe and 2 μL cDNA (1:5 diluted) totaling to 10 μL reaction volume, maintaining standard cycling conditions.

The quantity of DENV in sera was determined as previously described, with modification: the DENV-2 probe fluorophore was changed to JOE^{71 (link)}. RNA was extracted from sera using the MagMAX 96 Viral RNA Kit, and RNA was extracted from cell culture media using the MagMAX Pathogen RNA/DNA kit, on the KingFisher Flex Purification System. Eluted RNA was quantified by qRT-PCR using the SuperScript III Platinum One-Step qRT-PCR kit (Thermo Fisher Scientific) on the QuantStudio 7-Flex Real-Time PCR instrument (Thermo Fisher Scientific). DENV RNAemia was calculated as genome equivalents (GE) per mL using an internal standard curve of 10-fold serially diluted in vitro-transcribed RNA. The limit of quantitation, defined here as detection of a standard curve dilution in ≥95% of at least 20 replicates curves tested, for the DENV-2 assay is 50 GE/reaction. Values for undetectable sera samples were replaced with 100 GE/mL for the purposes of statistical analysis and graphing; this value is one-half of a theoretical minimum of one detected copy per reaction multiplied by the assay dilution factor of 200 to achieve per mL concentrations.

Plasma, cerebrospinal fluid, vaginal swab medium, aqueous and vitreous humor were inactivated in TRIzol LS according to the manufacturer’s instructions (Thermo Fisher Scientific, Waltham, MA, USA) and removed from the BSL-4. RNA was isolated using QIAamp Viral RNA Mini Kit (Qiagen, Germantown, MD, USA) BEI Resources Critical Reagents Program (CRP) EZ1 RT-PCR kit assay according to the manufacturer’s manual^{32 (link)} and analyzed on an QuantStudio 7 Flex Real-Time PCR instrument (Thermo Fisher Scientific) with a lower limit of quantitation of 1 × 10² genome equivalents (GEq) per reaction. Attempts to isolate infectious EBOV from aqueous and vitreous humor were performed by making a 1:10 dilution of sample in Gibco minimum essential medium (MEM; Thermo Fisher Scientific) and adsorption of inoculum on Vero E6 cell monolayers (#NR-596; Vero C1008 [E6] grivet kidney cells, American Type Culture Collection [ATCC]) at 37°C for 1 h. Following inoculation, cell cultures were monitored for presence of cytopathic effect (CPE) for up to 7 d, and supernatant was harvested for RNA extraction followed by RT-qPCR analysis as described.